EMAIL THIS PAGE TO A FRIEND

CBX7

chromobox homolog 7

130 Gene Product Result for
UniProtKB ID: O95931, Q86T17
Gene ID:
Mouse(52609) chromobox 7
Rat(362962) chromobox homolog 7
chicken(418017) chromobox homolog 7
chicken(101752246) chromobox homolog 7
chicken(101668582) chromobox homolog 7
dog(481247) chromobox homolog 7
domestic cat(101082836) chromobox homolog 7
cow(525770) chromobox homolog 7
domestic guinea pig(100735098) chromobox homolog 7
naked mole-rat(101700026) chromobox homolog 7
sheep(101122687) chromobox homolog 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175709 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175709 Rosetta Predictions human pricing
NM_199117 Rosetta Predictions rat pricing
NM_144811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147102 predicted 1171
2 SASI_Hs01_00147103 predicted 999
3 SASI_Hs01_00147104 predicted 1143
4 SASI_Hs01_00147105 predicted 131
5 SASI_Hs01_00147106 predicted 1113
6 SASI_Hs01_00147107 predicted 757
7 SASI_Hs02_00369030 predicted 134
8 SASI_Hs02_00369031 predicted 988
9 SASI_Hs01_00147109 predicted 894
10 SASI_Hs01_00147110 predicted 521
11 SASI_Hs01_00147108 predicted 450
12 SASI_Hs01_00147111 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065954 predicted 795
2 SASI_Rn01_00065955 predicted 374
3 SASI_Rn01_00065956 predicted 380
4 SASI_Rn01_00065957 predicted 1158
5 SASI_Rn01_00065958 predicted 663
6 SASI_Rn01_00065959 predicted 897
7 SASI_Rn01_00065960 predicted 888
8 SASI_Rn01_00065961 predicted 230
9 SASI_Rn01_00065962 predicted 1156
10 SASI_Rn01_00065963 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340166 predicted 864
2 SASI_Mm02_00340167 predicted 904
3 SASI_Mm01_00064320 predicted 583
4 SASI_Mm02_00340168 predicted 968
5 SASI_Mm01_00064321 predicted 270
6 SASI_Mm02_00340169 predicted 1032
7 SASI_Mm01_00064322 predicted 553
8 SASI_Mm01_00064324 predicted 511
9 SASI_Mm02_00340170 predicted 747
10 SASI_Mm02_00340171 predicted 1020
11 SASI_Mm01_00064319 predicted 496
12 SASI_Mm01_00064323 predicted 960
13 SASI_Mm01_00064325 predicted 400
14 SASI_Mm01_00064326 predicted 583
15 SASI_Mm01_00064327 predicted 540
16 SASI_Mm01_00064328 predicted 958
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175709
VALIDATED
CBX7 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175709.3-155s21c1
Sequence:CCGGGAAGGGTAAAGTCGAGTATCTCTCGAGAGATACTCGACTTTACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175709.3-835s21c1
Sequence:CCGGGGAAGTTCTGAATCACCGTTTCTCGAGAAACGGTGATTCAGAACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175709.3-2610s21c1
Sequence:CCGGTTTAGTTGTCCACGGTCAATTCTCGAGAATTGACCGTGGACAACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175709.3-295s21c1
Sequence:CCGGATAGGAAGAGAGGTCCGAAACCTCGAGGTTTCGGACCTCTCTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_175709.1-153s1c1
Sequence:CCGGCGGAAGGGTAAAGTCGAGTATCTCGAGATACTCGACTTTACCCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175709.1-752s1c1
Sequence:CCGGCGTGACCGACATCACCGCCAACTCGAGTTGGCGGTGATGTCGGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175709.1-736s1c1
Sequence:CCGGCCTCAAGTGAGGTGACCGTGACTCGAGTCACGGTCACCTCACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175709.1-122s1c1
Sequence:CCGGCGCCGTGGAGAGCATCCGGAACTCGAGTTCCGGATGCTCTCCACGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175709.1-293s1c1
Sequence:CCGGGTATAGGAAGAGAGGTCCGAACTCGAGTTCGGACCTCTCTTCCTATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175709
VALIDATED
CBX7 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175709.3-155s21c1
Sequence:CCGGGAAGGGTAAAGTCGAGTATCTCTCGAGAGATACTCGACTTTACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175709.3-835s21c1
Sequence:CCGGGGAAGTTCTGAATCACCGTTTCTCGAGAAACGGTGATTCAGAACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175709.3-2610s21c1
Sequence:CCGGTTTAGTTGTCCACGGTCAATTCTCGAGAATTGACCGTGGACAACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175709.3-295s21c1
Sequence:CCGGATAGGAAGAGAGGTCCGAAACCTCGAGGTTTCGGACCTCTCTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_175709.1-153s1c1
Sequence:CCGGCGGAAGGGTAAAGTCGAGTATCTCGAGATACTCGACTTTACCCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175709.1-752s1c1
Sequence:CCGGCGTGACCGACATCACCGCCAACTCGAGTTGGCGGTGATGTCGGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175709.1-736s1c1
Sequence:CCGGCCTCAAGTGAGGTGACCGTGACTCGAGTCACGGTCACCTCACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175709.1-122s1c1
Sequence:CCGGCGCCGTGGAGAGCATCCGGAACTCGAGTTCCGGATGCTCTCCACGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175709.1-293s1c1
Sequence:CCGGGTATAGGAAGAGAGGTCCGAACTCGAGTTCGGACCTCTCTTCCTATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175709
VALIDATED
CBX7 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175709.3-155s21c1
Sequence:CCGGGAAGGGTAAAGTCGAGTATCTCTCGAGAGATACTCGACTTTACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175709.3-835s21c1
Sequence:CCGGGGAAGTTCTGAATCACCGTTTCTCGAGAAACGGTGATTCAGAACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175709.3-2610s21c1
Sequence:CCGGTTTAGTTGTCCACGGTCAATTCTCGAGAATTGACCGTGGACAACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175709.3-295s21c1
Sequence:CCGGATAGGAAGAGAGGTCCGAAACCTCGAGGTTTCGGACCTCTCTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_175709.1-153s1c1
Sequence:CCGGCGGAAGGGTAAAGTCGAGTATCTCGAGATACTCGACTTTACCCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175709.1-752s1c1
Sequence:CCGGCGTGACCGACATCACCGCCAACTCGAGTTGGCGGTGATGTCGGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175709.1-736s1c1
Sequence:CCGGCCTCAAGTGAGGTGACCGTGACTCGAGTCACGGTCACCTCACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175709.1-122s1c1
Sequence:CCGGCGCCGTGGAGAGCATCCGGAACTCGAGTTCCGGATGCTCTCCACGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175709.1-293s1c1
Sequence:CCGGGTATAGGAAGAGAGGTCCGAACTCGAGTTCGGACCTCTCTTCCTATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144811
CBX7 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144811.2-2702s1c1
Sequence:CCGGCCTGAATGTATTGGGAGGAATCTCGAGATTCCTCCCAATACATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144811.2-504s1c1
Sequence:CCGGCGTGACTGACATCACCGCCAACTCGAGTTGGCGGTGATGTCAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144811.2-191s1c1
Sequence:CCGGGCAAAGTTGAATATCTGGTGACTCGAGTCACCAGATATTCAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144811.2-184s1c1
Sequence:CCGGCGGAAGGGCAAAGTTGAATATCTCGAGATATTCAACTTTGCCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144811.2-488s1c1
Sequence:CCGGCCTCAAGTGAAGTTACCGTGACTCGAGTCACGGTAACTTCACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144811
CBX7 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144811.2-2702s1c1
Sequence:CCGGCCTGAATGTATTGGGAGGAATCTCGAGATTCCTCCCAATACATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144811.2-504s1c1
Sequence:CCGGCGTGACTGACATCACCGCCAACTCGAGTTGGCGGTGATGTCAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144811.2-191s1c1
Sequence:CCGGGCAAAGTTGAATATCTGGTGACTCGAGTCACCAGATATTCAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144811.2-184s1c1
Sequence:CCGGCGGAAGGGCAAAGTTGAATATCTCGAGATATTCAACTTTGCCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144811.2-488s1c1
Sequence:CCGGCCTCAAGTGAAGTTACCGTGACTCGAGTCACGGTAACTTCACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144811
CBX7 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144811.2-2702s1c1
Sequence:CCGGCCTGAATGTATTGGGAGGAATCTCGAGATTCCTCCCAATACATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144811.2-504s1c1
Sequence:CCGGCGTGACTGACATCACCGCCAACTCGAGTTGGCGGTGATGTCAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144811.2-191s1c1
Sequence:CCGGGCAAAGTTGAATATCTGGTGACTCGAGTCACCAGATATTCAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144811.2-184s1c1
Sequence:CCGGCGGAAGGGCAAAGTTGAATATCTCGAGATATTCAACTTTGCCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144811.2-488s1c1
Sequence:CCGGCCTCAAGTGAAGTTACCGTGACTCGAGTCACGGTAACTTCACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks