EMAIL THIS PAGE TO A FRIEND

CBX8

chromobox homolog 8

77 Gene Product Result for
Synonyms: PC3 RC1
UniProtKB ID: Q9HC52, Q96H39, Q9NR07
Gene ID:
Mouse(30951) chromobox 8
Rat(303731) chromobox homolog 8
chicken(422084) chromobox homolog 8
domestic cat(101085085) chromobox homolog 8
cow(506458) chromobox homolog 8
dog(608591) chromobox homolog 8
sheep(101111208) chromobox homolog 8
naked mole-rat(101714447) chromobox homolog 8
domestic guinea pig(100727473) chromobox homolog 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34600 Anti-CBX8 (AB1) antibody produced in rabbit affinity isolated antibody human, bovine, rabbit, canine, rat, guinea pig, mouse, horse
western blot pricing
AV39422 Anti-CBX8 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, canine, bovine, human, rabbit, zebrafish, guinea pig, horse, rat,
western blot pricing
SAB2500210 Anti-CBX8 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine, mouse
ELISA, western blot pricing
HPA031462 Anti-CBX8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104200 Anti-CBX8, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, guinea pig, horse, mouse, canine, rabbit, zebrafish, human, bovine
western blot pricing
SAB4100529 Monoclonal Anti-CBX8 antibody produced in mouse clone CBX8-A477, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020649 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020649 Rosetta Predictions human pricing
NM_001034078 Rosetta Predictions rat pricing
NM_013926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047550 predicted 237
2 SASI_Hs01_00047551 predicted 212
3 SASI_Hs01_00047552 predicted 210
4 SASI_Hs01_00047553 predicted 229
5 SASI_Hs01_00047554 predicted 296
6 SASI_Hs01_00047555 predicted 298
7 SASI_Hs01_00047556 predicted 324
8 SASI_Hs01_00047557 predicted 1295
9 SASI_Hs01_00047558 predicted 241
10 SASI_Hs01_00047559 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108512 predicted 342
2 SASI_Rn01_00108513 predicted 481
3 SASI_Rn01_00108515 predicted 561
4 SASI_Rn01_00108516 predicted 283
5 SASI_Rn01_00108517 predicted 312
6 SASI_Rn02_00203929 predicted 593
7 SASI_Rn01_00108519 predicted 754
8 SASI_Rn01_00108520 predicted 1034
9 SASI_Rn01_00108521 predicted 1072
10 SASI_Rn02_00203930 predicted 1086
11 SASI_Rn01_00108514 predicted 557
12 SASI_Rn01_00108518 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087962 predicted 332
2 SASI_Mm01_00087963 predicted 741
3 SASI_Mm01_00087964 predicted 695
4 SASI_Mm01_00087966 predicted 1049
5 SASI_Mm01_00087967 predicted 816
6 SASI_Mm02_00323022 predicted 1051
7 SASI_Mm01_00087968 predicted 341
8 SASI_Mm01_00087969 predicted 667
9 SASI_Mm01_00087970 predicted 1114
10 SASI_Mm01_00087971 predicted 358
11 SASI_Mm01_00087965 predicted 1064
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013926
VALIDATED
CBX8 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013926.1-1195s1c1
Sequence:CCGGGCTCAAATGGCTTAGTGCTTTCTCGAGAAAGCACTAAGCCATTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013926.1-1042s1c1
Sequence:CCGGTCTCTGACTAACCTGGAGAAACTCGAGTTTCTCCAGGTTAGTCAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013926.1-395s1c1
Sequence:CCGGCCCAGGATTTGGCGTCTACTTCTCGAGAAGTAGACGCCAAATCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013926.1-1098s1c1
Sequence:CCGGCGTCACCATTAAGGAGAGCAACTCGAGTTGCTCTCCTTAATGGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013926.1-136s1c1
Sequence:CCGGCGCATGGAATATCTCGTGAAACTCGAGTTTCACGAGATATTCCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013926.1-744s21c1
Sequence:CCGGGGACTCAGACCTGGTGCAATACTCGAGTATTGCACCAGGTCTGAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013926.1-1118s21c1
Sequence:CCGGACACGGACCAAGGATTCTTTACTCGAGTAAAGAATCCTTGGTCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013926.1-820s21c1
Sequence:CCGGTTTCCAGCCAGGGTAATAAAGCTCGAGCTTTATTACCCTGGCTGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013926.1-137s21c1
Sequence:CCGGGCATGGAATATCTCGTGAAATCTCGAGATTTCACGAGATATTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013926.1-1195s21c1
Sequence:CCGGGCTCAAATGGCTTAGTGCTTTCTCGAGAAAGCACTAAGCCATTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013926
VALIDATED
CBX8 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013926.1-1195s1c1
Sequence:CCGGGCTCAAATGGCTTAGTGCTTTCTCGAGAAAGCACTAAGCCATTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013926.1-1042s1c1
Sequence:CCGGTCTCTGACTAACCTGGAGAAACTCGAGTTTCTCCAGGTTAGTCAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013926.1-395s1c1
Sequence:CCGGCCCAGGATTTGGCGTCTACTTCTCGAGAAGTAGACGCCAAATCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013926.1-1098s1c1
Sequence:CCGGCGTCACCATTAAGGAGAGCAACTCGAGTTGCTCTCCTTAATGGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013926.1-136s1c1
Sequence:CCGGCGCATGGAATATCTCGTGAAACTCGAGTTTCACGAGATATTCCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013926.1-744s21c1
Sequence:CCGGGGACTCAGACCTGGTGCAATACTCGAGTATTGCACCAGGTCTGAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013926.1-1118s21c1
Sequence:CCGGACACGGACCAAGGATTCTTTACTCGAGTAAAGAATCCTTGGTCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013926.1-820s21c1
Sequence:CCGGTTTCCAGCCAGGGTAATAAAGCTCGAGCTTTATTACCCTGGCTGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013926.1-137s21c1
Sequence:CCGGGCATGGAATATCTCGTGAAATCTCGAGATTTCACGAGATATTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013926.1-1195s21c1
Sequence:CCGGGCTCAAATGGCTTAGTGCTTTCTCGAGAAAGCACTAAGCCATTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013926
VALIDATED
CBX8 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013926.1-1195s1c1
Sequence:CCGGGCTCAAATGGCTTAGTGCTTTCTCGAGAAAGCACTAAGCCATTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013926.1-1042s1c1
Sequence:CCGGTCTCTGACTAACCTGGAGAAACTCGAGTTTCTCCAGGTTAGTCAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013926.1-395s1c1
Sequence:CCGGCCCAGGATTTGGCGTCTACTTCTCGAGAAGTAGACGCCAAATCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013926.1-1098s1c1
Sequence:CCGGCGTCACCATTAAGGAGAGCAACTCGAGTTGCTCTCCTTAATGGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013926.1-136s1c1
Sequence:CCGGCGCATGGAATATCTCGTGAAACTCGAGTTTCACGAGATATTCCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013926.1-744s21c1
Sequence:CCGGGGACTCAGACCTGGTGCAATACTCGAGTATTGCACCAGGTCTGAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013926.1-1118s21c1
Sequence:CCGGACACGGACCAAGGATTCTTTACTCGAGTAAAGAATCCTTGGTCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013926.1-820s21c1
Sequence:CCGGTTTCCAGCCAGGGTAATAAAGCTCGAGCTTTATTACCCTGGCTGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013926.1-137s21c1
Sequence:CCGGGCATGGAATATCTCGTGAAATCTCGAGATTTCACGAGATATTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013926.1-1195s21c1
Sequence:CCGGGCTCAAATGGCTTAGTGCTTTCTCGAGAAAGCACTAAGCCATTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020649
VALIDATED
CBX8 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020649.1-274s1c1
Sequence:CCGGGAAAGAGAGATGGAGCTCTATCTCGAGATAGAGCTCCATCTCTCTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020649.1-166s1c1
Sequence:CCGGCGCATGGAATACCTCGTGAAACTCGAGTTTCACGAGGTATTCCATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020649.1-1183s1c1
Sequence:CCGGACGGACGTGACCTCAAACTTTCTCGAGAAAGTTTGAGGTCACGTCCGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020649.1-244s1c1
Sequence:CCGGGCTCGCTTGCTCGCAGCCTTTCTCGAGAAAGGCTGCGAGCAAGCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020649.1-167s21c1
Sequence:CCGGGCATGGAATACCTCGTGAAATCTCGAGATTTCACGAGGTATTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_020649.1-364s21c1
Sequence:CCGGACTTACGAGTTTCGAAGTGACCTCGAGGTCACTTCGAAACTCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_020649.1-1182s21c1
Sequence:CCGGCACGGACGTGACCTCAAACTTCTCGAGAAGTTTGAGGTCACGTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_020649.1-1308s21c1
Sequence:CCGGGCGTGAGCTTGGCATAGTGATCTCGAGATCACTATGCCAAGCTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020649
VALIDATED
CBX8 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020649.1-274s1c1
Sequence:CCGGGAAAGAGAGATGGAGCTCTATCTCGAGATAGAGCTCCATCTCTCTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020649.1-166s1c1
Sequence:CCGGCGCATGGAATACCTCGTGAAACTCGAGTTTCACGAGGTATTCCATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020649.1-1183s1c1
Sequence:CCGGACGGACGTGACCTCAAACTTTCTCGAGAAAGTTTGAGGTCACGTCCGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020649.1-244s1c1
Sequence:CCGGGCTCGCTTGCTCGCAGCCTTTCTCGAGAAAGGCTGCGAGCAAGCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020649.1-167s21c1
Sequence:CCGGGCATGGAATACCTCGTGAAATCTCGAGATTTCACGAGGTATTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_020649.1-364s21c1
Sequence:CCGGACTTACGAGTTTCGAAGTGACCTCGAGGTCACTTCGAAACTCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_020649.1-1182s21c1
Sequence:CCGGCACGGACGTGACCTCAAACTTCTCGAGAAGTTTGAGGTCACGTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_020649.1-1308s21c1
Sequence:CCGGGCGTGAGCTTGGCATAGTGATCTCGAGATCACTATGCCAAGCTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020649
VALIDATED
CBX8 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020649.1-274s1c1
Sequence:CCGGGAAAGAGAGATGGAGCTCTATCTCGAGATAGAGCTCCATCTCTCTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020649.1-166s1c1
Sequence:CCGGCGCATGGAATACCTCGTGAAACTCGAGTTTCACGAGGTATTCCATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020649.1-1183s1c1
Sequence:CCGGACGGACGTGACCTCAAACTTTCTCGAGAAAGTTTGAGGTCACGTCCGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020649.1-244s1c1
Sequence:CCGGGCTCGCTTGCTCGCAGCCTTTCTCGAGAAAGGCTGCGAGCAAGCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020649.1-167s21c1
Sequence:CCGGGCATGGAATACCTCGTGAAATCTCGAGATTTCACGAGGTATTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_020649.1-364s21c1
Sequence:CCGGACTTACGAGTTTCGAAGTGACCTCGAGGTCACTTCGAAACTCGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_020649.1-1182s21c1
Sequence:CCGGCACGGACGTGACCTCAAACTTCTCGAGAAGTTTGAGGTCACGTCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_020649.1-1308s21c1
Sequence:CCGGGCGTGAGCTTGGCATAGTGATCTCGAGATCACTATGCCAAGCTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)