EMAIL THIS PAGE TO A FRIEND

CBY1

chibby homolog 1 (Drosophila)

66 Gene Product Result for
Synonyms: C22orf2 CBY HS508I15A PGEA1 PIGEA-14 PIGEA14 arb1
UniProtKB ID: Q9Y3M2, B2R4S2, Q66GT6, Q9UIK9
Gene ID:
Human(25776) Summary: Beta-catenin is a transcriptional activator and oncoprotein involved in the development of several cancers. The protein encoded by this gene interacts directly with the C-terminal region of beta-catenin, inhibiting oncogenic beta-catenin-mediated transcriptional activation by competing with transcription factors for binding to beta-catenin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(73739) chibby homolog 1 (Drosophila)
Rat(246768) chibby homolog 1 (Drosophila)
naked mole-rat(101704896) chibby homolog 1 (Drosophila)
domestic guinea pig(100729082) chibby homolog 1 (Drosophila)
sheep(101105234) chibby homolog 1 (Drosophila)
Zebrafish(326875) chibby homolog 1 (Drosophila)
chicken(771364) chibby homolog 1 (Drosophila)
cow(282859) chibby homolog 1 (Drosophila)
dog(481252) chibby homolog 1 (Drosophila)
domestic cat(101081147) chibby homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002880 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002880 Rosetta Predictions human pricing
NM_015373 Rosetta Predictions human pricing
NM_145676 Rosetta Predictions rat pricing
NM_028634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304244 predicted 949
2 SASI_Hs01_00082551 predicted 934
3 SASI_Hs01_00082552 predicted 1034
4 SASI_Hs01_00082554 predicted 1031
5 SASI_Hs01_00082555 predicted 938
6 SASI_Hs01_00082556 predicted 1019
7 SASI_Hs01_00082557 predicted 960
8 SASI_Hs01_00082558 predicted 994
9 SASI_Hs02_00304245 predicted 950
10 SASI_Hs02_00304246 predicted 953
11 SASI_Hs01_00082549 predicted 476
12 SASI_Hs01_00082550 predicted 998
13 SASI_Hs01_00082553 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347721 predicted 805
2 SASI_Hs01_00127327 predicted 792
3 SASI_Hs01_00127328 predicted 893
4 SASI_Hs01_00127330 predicted 895
5 SASI_Hs01_00127331 predicted 807
6 SASI_Hs01_00127332 predicted 883
7 SASI_Hs01_00127333 predicted 824
8 SASI_Hs01_00127334 predicted 849
9 SASI_Hs02_00347722 predicted 815
10 SASI_Hs02_00347723 predicted 805
11 SASI_Hs01_00127325 predicted 332
12 SASI_Hs01_00127326 predicted 855
13 SASI_Hs01_00127329 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105473 predicted 196
2 SASI_Rn01_00105475 predicted 235
3 SASI_Rn01_00105474 predicted 231
4 SASI_Rn01_00105476 predicted 331
5 SASI_Rn01_00105477 predicted 379
6 SASI_Rn01_00105478 predicted 334
7 SASI_Rn01_00105480 predicted 99
8 SASI_Rn01_00105482 predicted 407
9 SASI_Rn02_00268728 predicted 424
10 SASI_Rn02_00268729 predicted 329
11 SASI_Rn01_00105479 predicted 407
12 SASI_Rn01_00105481 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042445 predicted 826
2 SASI_Mm01_00042447 predicted 826
3 SASI_Mm01_00042448 predicted 454
4 SASI_Mm01_00042449 predicted 254
5 SASI_Mm01_00042450 predicted 381
6 SASI_Mm01_00042451 predicted 357
7 SASI_Mm01_00042452 predicted 415
8 SASI_Mm01_00042453 predicted 434
9 SASI_Mm01_00042454 predicted 591
10 SASI_Mm02_00334155 predicted 827
11 SASI_Mm01_00042446 predicted 838
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002880
VALIDATED
CBY1 MISSION shRNA Bacterial Glycerol Stock
chibby homolog 1 (Drosophila)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-1085s21c1
Sequence:CCGGAGCGGCTCTCTTGGCTCTTAACTCGAGTTAAGAGCCAAGAGAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-733s21c1
Sequence:CCGGCTGGAAGAGAGTATCATATAACTCGAGTTATATGATACTCTCTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002880.1-591s1c1
Sequence:CCGGCACTGCTGAATCCCACTTAATCTCGAGATTAAGTGGGATTCAGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001002880.1-553s1c1
Sequence:CCGGCTGAAAGTGGACATCTTATTACTCGAGTAATAAGATGTCCACTTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-590s21c1
Sequence:CCGGCCACTGCTGAATCCCACTTAACTCGAGTTAAGTGGGATTCAGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-524s21c1
Sequence:CCGGAGTTGGAGGAAGAGAACAATCCTCGAGGATTGTTCTCTTCCTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-421s21c1
Sequence:CCGGGGGCAAAGCCTGAAGTTTGAACTCGAGTTCAAACTTCAGGCTTTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-622s21c1
Sequence:CCGGCTGGATGAACTGAGGATCAGCCTCGAGGCTGATCCTCAGTTCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-308s21c1
Sequence:CCGGAGAAGACACCTCCTCGGAAGTCTCGAGACTTCCGAGGAGGTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002880.1-335s1c1
Sequence:CCGGCTCTCTCCAACCTGCATTCTTCTCGAGAAGAATGCAGGTTGGAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002880.1-1113s1c1
Sequence:CCGGCCTCTCTCTTCTTGCCTTTAACTCGAGTTAAAGGCAAGAAGAGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002880.1-732s1c1
Sequence:CCGGCCTGGAAGAGAGTATCATATACTCGAGTATATGATACTCTCTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002880
VALIDATED
CBY1 MISSION shRNA shRNA Plasmid DNA
chibby homolog 1 (Drosophila)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-1085s21c1
Sequence:CCGGAGCGGCTCTCTTGGCTCTTAACTCGAGTTAAGAGCCAAGAGAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-733s21c1
Sequence:CCGGCTGGAAGAGAGTATCATATAACTCGAGTTATATGATACTCTCTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002880.1-591s1c1
Sequence:CCGGCACTGCTGAATCCCACTTAATCTCGAGATTAAGTGGGATTCAGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001002880.1-553s1c1
Sequence:CCGGCTGAAAGTGGACATCTTATTACTCGAGTAATAAGATGTCCACTTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-590s21c1
Sequence:CCGGCCACTGCTGAATCCCACTTAACTCGAGTTAAGTGGGATTCAGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-524s21c1
Sequence:CCGGAGTTGGAGGAAGAGAACAATCCTCGAGGATTGTTCTCTTCCTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-421s21c1
Sequence:CCGGGGGCAAAGCCTGAAGTTTGAACTCGAGTTCAAACTTCAGGCTTTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-622s21c1
Sequence:CCGGCTGGATGAACTGAGGATCAGCCTCGAGGCTGATCCTCAGTTCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-308s21c1
Sequence:CCGGAGAAGACACCTCCTCGGAAGTCTCGAGACTTCCGAGGAGGTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002880.1-335s1c1
Sequence:CCGGCTCTCTCCAACCTGCATTCTTCTCGAGAAGAATGCAGGTTGGAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002880.1-1113s1c1
Sequence:CCGGCCTCTCTCTTCTTGCCTTTAACTCGAGTTAAAGGCAAGAAGAGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002880.1-732s1c1
Sequence:CCGGCCTGGAAGAGAGTATCATATACTCGAGTATATGATACTCTCTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002880
VALIDATED
CBY1 MISSION shRNA Lentiviral Transduction Particles
chibby homolog 1 (Drosophila)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-1085s21c1
Sequence:CCGGAGCGGCTCTCTTGGCTCTTAACTCGAGTTAAGAGCCAAGAGAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-733s21c1
Sequence:CCGGCTGGAAGAGAGTATCATATAACTCGAGTTATATGATACTCTCTTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002880.1-591s1c1
Sequence:CCGGCACTGCTGAATCCCACTTAATCTCGAGATTAAGTGGGATTCAGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001002880.1-553s1c1
Sequence:CCGGCTGAAAGTGGACATCTTATTACTCGAGTAATAAGATGTCCACTTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-590s21c1
Sequence:CCGGCCACTGCTGAATCCCACTTAACTCGAGTTAAGTGGGATTCAGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-524s21c1
Sequence:CCGGAGTTGGAGGAAGAGAACAATCCTCGAGGATTGTTCTCTTCCTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-421s21c1
Sequence:CCGGGGGCAAAGCCTGAAGTTTGAACTCGAGTTCAAACTTCAGGCTTTGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-622s21c1
Sequence:CCGGCTGGATGAACTGAGGATCAGCCTCGAGGCTGATCCTCAGTTCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001002880.1-308s21c1
Sequence:CCGGAGAAGACACCTCCTCGGAAGTCTCGAGACTTCCGAGGAGGTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002880.1-335s1c1
Sequence:CCGGCTCTCTCCAACCTGCATTCTTCTCGAGAAGAATGCAGGTTGGAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002880.1-1113s1c1
Sequence:CCGGCCTCTCTCTTCTTGCCTTTAACTCGAGTTAAAGGCAAGAAGAGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002880.1-732s1c1
Sequence:CCGGCCTGGAAGAGAGTATCATATACTCGAGTATATGATACTCTCTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028634
VALIDATED
CBY1 MISSION shRNA Bacterial Glycerol Stock
chibby homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028634.2-598s1c1
Sequence:CCGGCCCTTTGATTTCCCGTCAGATCTCGAGATCTGACGGGAAATCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028634.2-374s1c1
Sequence:CCGGGCGCAAACGAAACCAACAGTTCTCGAGAACTGTTGGTTTCGTTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028634.2-207s1c1
Sequence:CCGGTCCAACCTACATTCTTTAGATCTCGAGATCTAAAGAATGTAGGTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028634.2-381s1c1
Sequence:CCGGCGAAACCAACAGTTAGAAGAACTCGAGTTCTTCTAACTGTTGGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028634.2-257s1c1
Sequence:CCGGCGACTATGGAACTCCTACCATCTCGAGATGGTAGGAGTTCCATAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028634
VALIDATED
CBY1 MISSION shRNA shRNA Plasmid DNA
chibby homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028634.2-598s1c1
Sequence:CCGGCCCTTTGATTTCCCGTCAGATCTCGAGATCTGACGGGAAATCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028634.2-374s1c1
Sequence:CCGGGCGCAAACGAAACCAACAGTTCTCGAGAACTGTTGGTTTCGTTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028634.2-207s1c1
Sequence:CCGGTCCAACCTACATTCTTTAGATCTCGAGATCTAAAGAATGTAGGTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028634.2-381s1c1
Sequence:CCGGCGAAACCAACAGTTAGAAGAACTCGAGTTCTTCTAACTGTTGGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028634.2-257s1c1
Sequence:CCGGCGACTATGGAACTCCTACCATCTCGAGATGGTAGGAGTTCCATAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028634
VALIDATED
CBY1 MISSION shRNA Lentiviral Transduction Particles
chibby homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028634.2-598s1c1
Sequence:CCGGCCCTTTGATTTCCCGTCAGATCTCGAGATCTGACGGGAAATCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028634.2-374s1c1
Sequence:CCGGGCGCAAACGAAACCAACAGTTCTCGAGAACTGTTGGTTTCGTTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028634.2-207s1c1
Sequence:CCGGTCCAACCTACATTCTTTAGATCTCGAGATCTAAAGAATGTAGGTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028634.2-381s1c1
Sequence:CCGGCGAAACCAACAGTTAGAAGAACTCGAGTTCTTCTAACTGTTGGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028634.2-257s1c1
Sequence:CCGGCGACTATGGAACTCCTACCATCTCGAGATGGTAGGAGTTCCATAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)