EMAIL THIS PAGE TO A FRIEND

CBY3

chibby homolog 3 (Drosophila)

70 Gene Product Result for
UniProtKB ID: A6NI87
Gene ID:
Mouse(76653) chibby homolog 3 (Drosophila)
Rat(690544) chibby homolog 3 (Drosophila)
cow(100301272) chibby homolog 3 (Drosophila)
dog(481456) chibby homolog 3 (Drosophila)
domestic cat(101096696) chibby homolog 3 (Drosophila)
sheep(101120079) chibby homolog 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_484016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU078341 MISSION® esiRNA esiRNA targeting mouse Cby3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001724133 Rosetta Predictions human pricing
XM_928982 Rosetta Predictions human pricing
XM_936994 Rosetta Predictions human pricing
XM_001074756 Rosetta Predictions rat pricing
XM_484016 Rosetta Predictions mouse pricing
XM_909594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00459664 predicted 409
2 SASI_Hs02_00459665 predicted 383
3 SASI_Hs02_00459666 predicted 448
4 SASI_Hs02_00459667 predicted 534
5 SASI_Hs02_00459668 predicted 553
6 SASI_Hs02_00459669 predicted 524
7 SASI_Hs02_00459670 predicted 217
8 SASI_Hs02_00459671 predicted 427
9 SASI_Hs02_00459672 predicted 409
10 SASI_Hs02_00459673 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281472 predicted 414
2 SASI_Hs01_00281473 predicted 381
3 SASI_Hs01_00281474 predicted 450
4 SASI_Hs01_00281475 predicted 526
5 SASI_Hs02_00480992 predicted 557
6 SASI_Hs01_00281476 predicted 528
7 SASI_Hs01_00281477 predicted 215
8 SASI_Hs01_00281479 predicted 432
9 SASI_Hs01_00281480 predicted 414
10 SASI_Hs01_00281481 predicted 252
11 SASI_Hs01_00281478 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_936994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482370 predicted 411
2 SASI_Hs02_00482371 predicted 383
3 SASI_Hs02_00482372 predicted 448
4 SASI_Hs02_00482373 predicted 533
5 SASI_Hs02_00482374 predicted 555
6 SASI_Hs02_00482375 predicted 528
7 SASI_Hs02_00482376 predicted 218
8 SASI_Hs02_00482377 predicted 432
9 SASI_Hs02_00482378 predicted 408
10 SASI_Hs02_00482379 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347254 predicted 527
2 SASI_Rn02_00347255 predicted 282
3 SASI_Rn02_00347256 predicted 213
4 SASI_Rn02_00347257 predicted 263
5 SASI_Rn02_00347258 predicted 496
6 SASI_Rn02_00347259 predicted 261
7 SASI_Rn02_00347260 predicted 294
8 SASI_Rn02_00347261 predicted 275
9 SASI_Rn02_00347262 predicted 544
10 SASI_Rn02_00347263 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426384 predicted 737
2 SASI_Mm01_00234191 predicted 635
3 SASI_Mm01_00234193 predicted 536
4 SASI_Mm01_00234195 predicted 508
5 SASI_Mm01_00234196 predicted 702
6 SASI_Mm01_00234198 predicted 748
7 SASI_Mm01_00234199 predicted 541
8 SASI_Mm02_00426385 predicted 531
9 SASI_Mm02_00426386 predicted 548
10 SASI_Mm02_00426387 predicted 617
11 SASI_Mm01_00234190 predicted 206
12 SASI_Mm01_00234192 predicted 466
13 SASI_Mm01_00234194 predicted 211
14 SASI_Mm01_00234197 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434916 predicted 213
2 SASI_Mm02_00434917 predicted 359
3 SASI_Mm02_00434918 predicted 467
4 SASI_Mm02_00434919 predicted 262
5 SASI_Mm02_00434920 predicted 207
6 SASI_Mm02_00434921 predicted 236
7 SASI_Mm02_00434922 predicted 427
8 SASI_Mm02_00434923 predicted 250
9 SASI_Mm02_00434924 predicted 480
10 SASI_Mm02_00434925 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484016
CBY3 MISSION shRNA Bacterial Glycerol Stock
chibby homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-63s1c1
Sequence:CCGGGCACTGCCATATACCTATGTTCTCGAGAACATAGGTATATGGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-821s1c1
Sequence:CCGGTGGACATGCTAACAGAGACTACTCGAGTAGTCTCTGTTAGCATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-476s1c1
Sequence:CCGGTGTGGAAACAGGTGAGGCAATCTCGAGATTGCCTCACCTGTTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-774s1c1
Sequence:CCGGGCTGCTGGAAGAGAATAACTACTCGAGTAGTTATTCTCTTCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-543s1c1
Sequence:CCGGGCTGCGCCATATCTCATCCATCTCGAGATGGATGAGATATGGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484016
CBY3 MISSION shRNA shRNA Plasmid DNA
chibby homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-63s1c1
Sequence:CCGGGCACTGCCATATACCTATGTTCTCGAGAACATAGGTATATGGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-821s1c1
Sequence:CCGGTGGACATGCTAACAGAGACTACTCGAGTAGTCTCTGTTAGCATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-476s1c1
Sequence:CCGGTGTGGAAACAGGTGAGGCAATCTCGAGATTGCCTCACCTGTTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-774s1c1
Sequence:CCGGGCTGCTGGAAGAGAATAACTACTCGAGTAGTTATTCTCTTCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-543s1c1
Sequence:CCGGGCTGCGCCATATCTCATCCATCTCGAGATGGATGAGATATGGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484016
CBY3 MISSION shRNA Lentiviral Transduction Particles
chibby homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-63s1c1
Sequence:CCGGGCACTGCCATATACCTATGTTCTCGAGAACATAGGTATATGGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-821s1c1
Sequence:CCGGTGGACATGCTAACAGAGACTACTCGAGTAGTCTCTGTTAGCATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-476s1c1
Sequence:CCGGTGTGGAAACAGGTGAGGCAATCTCGAGATTGCCTCACCTGTTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-774s1c1
Sequence:CCGGGCTGCTGGAAGAGAATAACTACTCGAGTAGTTATTCTCTTCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484016.1-543s1c1
Sequence:CCGGGCTGCGCCATATCTCATCCATCTCGAGATGGATGAGATATGGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks