EMAIL THIS PAGE TO A FRIEND

CC2D1A

coiled-coil and C2 domain containing 1A

61 Gene Product Result for
Synonyms: FREUD-1 Freud-1/Aki1 MRT3
UniProtKB ID: Q6P1N0, Q7Z435, Q86XV0, Q8NF89, Q9H603, Q9NXI1
Gene ID:
Human(54862) Summary: This gene encodes a transcriptional repressor that binds to a conserved 14-bp 5'-repressor element and regulates expression of the 5-hydroxytryptamine (serotonin) receptor 1A gene in neuronal cells. The DNA binding and transcriptional repressor activities of the protein are inhibited by calcium. A mutation in this gene results in nonsyndromic mental retardation-3.[provided by RefSeq, Oct 2009]
Mouse(212139) coiled-coil and C2 domain containing 1A
Rat(288908) coiled-coil and C2 domain containing 1A
cow(513078) coiled-coil and C2 domain containing 1A
dog(484911) coiled-coil and C2 domain containing 1A
domestic cat(101089748) coiled-coil and C2 domain containing 1A
naked mole-rat(101702215) coiled-coil and C2 domain containing 1A
domestic guinea pig(100712639) coiled-coil and C2 domain containing 1A
sheep(101119902) coiled-coil and C2 domain containing 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145970 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145970 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145970 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017721 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017721 Rosetta Predictions human pricing
NM_001013869 Rosetta Predictions rat pricing
NM_145970 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128856 predicted 1053
2 SASI_Hs01_00128857 predicted 2176
3 SASI_Hs01_00128858 predicted 2239
4 SASI_Hs01_00128860 predicted 2318
5 SASI_Hs01_00128861 predicted 1032
6 SASI_Hs01_00128862 predicted 2393
7 SASI_Hs01_00128863 predicted 2401
8 SASI_Hs01_00128864 predicted 631
9 SASI_Hs01_00128865 predicted 1069
10 SASI_Hs02_00350493 predicted 2007
11 SASI_Hs01_00128859 predicted 2327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114429 predicted 1962
2 SASI_Rn01_00114430 predicted 2184
3 SASI_Rn01_00114432 predicted 1144
4 SASI_Rn01_00114433 predicted 1647
5 SASI_Rn01_00114434 predicted 1762
6 SASI_Rn02_00201137 predicted 574
7 SASI_Rn01_00114435 predicted 1130
8 SASI_Rn01_00114436 predicted 1953
9 SASI_Rn01_00114437 predicted 610
10 SASI_Rn02_00201138 predicted 2280
11 SASI_Rn01_00114431 predicted 2914
12 SASI_Rn01_00114438 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145970 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341458 predicted 2215
2 SASI_Mm02_00341459 predicted 667
3 SASI_Mm02_00341460 predicted 2667
4 SASI_Mm02_00341461 predicted 578
5 SASI_Mm02_00341462 predicted 1964
6 SASI_Mm02_00341463 predicted 1788
7 SASI_Mm02_00341464 predicted 2145
8 SASI_Mm02_00341465 predicted 880
9 SASI_Mm02_00341466 predicted 2820
10 SASI_Mm02_00341467 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145970
VALIDATED
CC2D1A MISSION shRNA Bacterial Glycerol Stock
coiled-coil and C2 domain containing 1A
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201530    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145970.1-3169s1c1
Sequence:CCGGCCTCTCCAAAGATACCTCTGACTCGAGTCAGAGGTATCTTTGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-2937s21c1
Sequence:CCGGCGAACAGACAAGCAGACAATCCTCGAGGATTGTCTGCTTGTCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-1161s21c1
Sequence:CCGGGAACGAATTGTCAAGCAATACCTCGAGGTATTGCTTGACAATTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-1877s21c1
Sequence:CCGGGCGGAGCATGGACACCTTAAACTCGAGTTTAAGGTGTCCATGCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-2070s21c1
Sequence:CCGGGTCCGCTTTGACTTCCCTTATCTCGAGATAAGGGAAGTCAAAGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-1829s21c1
Sequence:CCGGCAACATTGCTGAAACCATTAACTCGAGTTAATGGTTTCAGCAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145970
VALIDATED
CC2D1A MISSION shRNA shRNA Plasmid DNA
coiled-coil and C2 domain containing 1A
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201530    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145970.1-3169s1c1
Sequence:CCGGCCTCTCCAAAGATACCTCTGACTCGAGTCAGAGGTATCTTTGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-2937s21c1
Sequence:CCGGCGAACAGACAAGCAGACAATCCTCGAGGATTGTCTGCTTGTCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-1161s21c1
Sequence:CCGGGAACGAATTGTCAAGCAATACCTCGAGGTATTGCTTGACAATTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-1877s21c1
Sequence:CCGGGCGGAGCATGGACACCTTAAACTCGAGTTTAAGGTGTCCATGCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-2070s21c1
Sequence:CCGGGTCCGCTTTGACTTCCCTTATCTCGAGATAAGGGAAGTCAAAGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-1829s21c1
Sequence:CCGGCAACATTGCTGAAACCATTAACTCGAGTTAATGGTTTCAGCAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145970
VALIDATED
CC2D1A MISSION shRNA Lentiviral Transduction Particles
coiled-coil and C2 domain containing 1A
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201530    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145970.1-3169s1c1
Sequence:CCGGCCTCTCCAAAGATACCTCTGACTCGAGTCAGAGGTATCTTTGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-2937s21c1
Sequence:CCGGCGAACAGACAAGCAGACAATCCTCGAGGATTGTCTGCTTGTCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-1161s21c1
Sequence:CCGGGAACGAATTGTCAAGCAATACCTCGAGGTATTGCTTGACAATTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-1877s21c1
Sequence:CCGGGCGGAGCATGGACACCTTAAACTCGAGTTTAAGGTGTCCATGCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-2070s21c1
Sequence:CCGGGTCCGCTTTGACTTCCCTTATCTCGAGATAAGGGAAGTCAAAGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145970.1-1829s21c1
Sequence:CCGGCAACATTGCTGAAACCATTAACTCGAGTTAATGGTTTCAGCAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017721
VALIDATED
CC2D1A MISSION shRNA Bacterial Glycerol Stock
coiled-coil and C2 domain containing 1A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017721.x-3278s1c1
Sequence:CCGGCGAACCAGACAAGCAGACAATCTCGAGATTGTCTGCTTGTCTGGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017721.x-1490s1c1
Sequence:CCGGCGCATCGTCAAGCAATACCAACTCGAGTTGGTATTGCTTGACGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017721.x-2477s1c1
Sequence:CCGGGAGTTCAAGGAGCAGTTCAAACTCGAGTTTGAACTGCTCCTTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017721.x-2128s1c1
Sequence:CCGGCCACTCAAACCAATTCACCCACTCGAGTGGGTGAATTGGTTTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017721.x-2384s1c1
Sequence:CCGGCTGGATGTCTTTGTTCGGTTTCTCGAGAAACCGAACAAAGACATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017721.4-2424s21c1
Sequence:CCGGGAGTTCAAGGAGCAGTTCAAACTCGAGTTTGAACTGCTCCTTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017721.4-2323s21c1
Sequence:CCGGCTGGCGATCTGGATGTCTTTGCTCGAGCAAAGACATCCAGATCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017721.4-2064s21c1
Sequence:CCGGATGTGCCTGAACCACTCAAACCTCGAGGTTTGAGTGGTTCAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017721.4-3228s21c1
Sequence:CCGGCGAACCAGACAAGCAGACAATCTCGAGATTGTCTGCTTGTCTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017721.4-1437s21c1
Sequence:CCGGCGCATCGTCAAGCAATACCAACTCGAGTTGGTATTGCTTGACGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017721
VALIDATED
CC2D1A MISSION shRNA shRNA Plasmid DNA
coiled-coil and C2 domain containing 1A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017721.x-3278s1c1
Sequence:CCGGCGAACCAGACAAGCAGACAATCTCGAGATTGTCTGCTTGTCTGGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017721.x-1490s1c1
Sequence:CCGGCGCATCGTCAAGCAATACCAACTCGAGTTGGTATTGCTTGACGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017721.x-2477s1c1
Sequence:CCGGGAGTTCAAGGAGCAGTTCAAACTCGAGTTTGAACTGCTCCTTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017721.x-2128s1c1
Sequence:CCGGCCACTCAAACCAATTCACCCACTCGAGTGGGTGAATTGGTTTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017721.x-2384s1c1
Sequence:CCGGCTGGATGTCTTTGTTCGGTTTCTCGAGAAACCGAACAAAGACATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017721.4-2424s21c1
Sequence:CCGGGAGTTCAAGGAGCAGTTCAAACTCGAGTTTGAACTGCTCCTTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017721.4-2323s21c1
Sequence:CCGGCTGGCGATCTGGATGTCTTTGCTCGAGCAAAGACATCCAGATCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017721.4-2064s21c1
Sequence:CCGGATGTGCCTGAACCACTCAAACCTCGAGGTTTGAGTGGTTCAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017721.4-3228s21c1
Sequence:CCGGCGAACCAGACAAGCAGACAATCTCGAGATTGTCTGCTTGTCTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017721.4-1437s21c1
Sequence:CCGGCGCATCGTCAAGCAATACCAACTCGAGTTGGTATTGCTTGACGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017721
VALIDATED
CC2D1A MISSION shRNA Lentiviral Transduction Particles
coiled-coil and C2 domain containing 1A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017721.x-3278s1c1
Sequence:CCGGCGAACCAGACAAGCAGACAATCTCGAGATTGTCTGCTTGTCTGGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017721.x-1490s1c1
Sequence:CCGGCGCATCGTCAAGCAATACCAACTCGAGTTGGTATTGCTTGACGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017721.x-2477s1c1
Sequence:CCGGGAGTTCAAGGAGCAGTTCAAACTCGAGTTTGAACTGCTCCTTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017721.x-2128s1c1
Sequence:CCGGCCACTCAAACCAATTCACCCACTCGAGTGGGTGAATTGGTTTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017721.x-2384s1c1
Sequence:CCGGCTGGATGTCTTTGTTCGGTTTCTCGAGAAACCGAACAAAGACATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017721.4-2424s21c1
Sequence:CCGGGAGTTCAAGGAGCAGTTCAAACTCGAGTTTGAACTGCTCCTTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017721.4-2323s21c1
Sequence:CCGGCTGGCGATCTGGATGTCTTTGCTCGAGCAAAGACATCCAGATCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017721.4-2064s21c1
Sequence:CCGGATGTGCCTGAACCACTCAAACCTCGAGGTTTGAGTGGTTCAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017721.4-3228s21c1
Sequence:CCGGCGAACCAGACAAGCAGACAATCTCGAGATTGTCTGCTTGTCTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017721.4-1437s21c1
Sequence:CCGGCGCATCGTCAAGCAATACCAACTCGAGTTGGTATTGCTTGACGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks