EMAIL THIS PAGE TO A FRIEND

CC2D1B

coiled-coil and C2 domain containing 1B

90 Gene Product Result for
Gene ID:
Mouse(319965) coiled-coil and C2 domain containing 1B
Rat(313478) coiled-coil and C2 domain containing 1B
sheep(101114826) coiled-coil and C2 domain containing 1B
Domestic Rabbit(100356306) coiled-coil and C2 domain containing 1B
domestic guinea pig(100723882) coiled-coil and C2 domain containing 1B
naked mole-rat(101712493) coiled-coil and C2 domain containing 1B
Zebrafish(563720) coiled-coil and C2 domain containing 1B
cow(511350) coiled-coil and C2 domain containing 1B
Horse(100050824) coiled-coil and C2 domain containing 1B
domestic cat(101090633) coiled-coil and C2 domain containing 1B
dog(482497) coiled-coil and C2 domain containing 1B
chicken(772226) coiled-coil and C2 domain containing 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032449 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177045 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177045 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177045 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032449 Rosetta Predictions human pricing
XM_001067280 Rosetta Predictions rat pricing
XM_233342 Rosetta Predictions rat pricing
NM_177045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359862 predicted 2460
2 SASI_Hs01_00184732 predicted 1425
3 SASI_Hs02_00359863 predicted 2544
4 SASI_Hs01_00184733 predicted 1990
5 SASI_Hs01_00184734 predicted 2392
6 SASI_Hs01_00184735 predicted 2317
7 SASI_Hs01_00184736 predicted 1824
8 SASI_Hs02_00359864 predicted 1934
9 SASI_Hs01_00184737 predicted 1983
10 SASI_Hs01_00184738 predicted 1577
11 SASI_Hs01_00184739 predicted 2409
12 SASI_Hs01_00184740 predicted 1437
13 SASI_Hs01_00184741 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320500 predicted 1400
2 SASI_Rn02_00320501 predicted 2535
3 SASI_Rn02_00320502 predicted 1810
4 SASI_Rn02_00320503 predicted 2043
5 SASI_Rn02_00320504 predicted 2364
6 SASI_Rn02_00320505 predicted 2408
7 SASI_Rn02_00320506 predicted 560
8 SASI_Rn02_00320507 predicted 2167
9 SASI_Rn02_00320508 predicted 524
10 SASI_Rn02_00320509 predicted 2425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387672 predicted 2535
2 SASI_Rn02_00387673 predicted 2444
3 SASI_Rn02_00387674 predicted 2450
4 SASI_Rn02_00387675 predicted 2497
5 SASI_Rn02_00387676 predicted 2445
6 SASI_Rn02_00387677 predicted 2412
7 SASI_Rn02_00387678 predicted 2427
8 SASI_Rn02_00387679 predicted 2540
9 SASI_Rn02_00387680 predicted 2449
10 SASI_Rn02_00387681 predicted 2555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098153 predicted 2281
2 SASI_Mm01_00098154 predicted 1502
3 SASI_Mm01_00098155 predicted 2429
4 SASI_Mm01_00098156 predicted 1505
5 SASI_Mm01_00098158 predicted 2341
6 SASI_Mm01_00098159 predicted 1383
7 SASI_Mm01_00098160 predicted 1790
8 SASI_Mm01_00098161 predicted 528
9 SASI_Mm01_00098162 predicted 1380
10 SASI_Mm02_00346996 predicted 2728
11 SASI_Mm01_00098157 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032449
VALIDATED
CC2D1B MISSION shRNA Bacterial Glycerol Stock
coiled-coil and C2 domain containing 1B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032449.1-1760s21c1
Sequence:CCGGAGGCACGGAAACTGCAGTATCCTCGAGGATACTGCAGTTTCCGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032449.1-2474s21c1
Sequence:CCGGAGTTTGAGATCTTCCACAAAGCTCGAGCTTTGTGGAAGATCTCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032449.1-1432s1c1
Sequence:CCGGCGGAAAGTCAACTTTGCTGAACTCGAGTTCAGCAAAGTTGACTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032449.1-1702s1c1
Sequence:CCGGGCCTCAAGTTCTAAGGAGTCACTCGAGTGACTCCTTAGAACTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032449.1-4183s1c1
Sequence:CCGGGCTCAAGAACTGAGCTTTGTACTCGAGTACAAAGCTCAGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032449.1-2550s1c1
Sequence:CCGGGCTGGAGAATGAGTGTGAGATCTCGAGATCTCACACTCATTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032449
VALIDATED
CC2D1B MISSION shRNA shRNA Plasmid DNA
coiled-coil and C2 domain containing 1B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032449.1-1760s21c1
Sequence:CCGGAGGCACGGAAACTGCAGTATCCTCGAGGATACTGCAGTTTCCGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032449.1-2474s21c1
Sequence:CCGGAGTTTGAGATCTTCCACAAAGCTCGAGCTTTGTGGAAGATCTCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032449.1-1432s1c1
Sequence:CCGGCGGAAAGTCAACTTTGCTGAACTCGAGTTCAGCAAAGTTGACTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032449.1-1702s1c1
Sequence:CCGGGCCTCAAGTTCTAAGGAGTCACTCGAGTGACTCCTTAGAACTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032449.1-4183s1c1
Sequence:CCGGGCTCAAGAACTGAGCTTTGTACTCGAGTACAAAGCTCAGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032449.1-2550s1c1
Sequence:CCGGGCTGGAGAATGAGTGTGAGATCTCGAGATCTCACACTCATTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032449
VALIDATED
CC2D1B MISSION shRNA Lentiviral Transduction Particles
coiled-coil and C2 domain containing 1B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032449.1-1760s21c1
Sequence:CCGGAGGCACGGAAACTGCAGTATCCTCGAGGATACTGCAGTTTCCGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032449.1-2474s21c1
Sequence:CCGGAGTTTGAGATCTTCCACAAAGCTCGAGCTTTGTGGAAGATCTCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032449.1-1432s1c1
Sequence:CCGGCGGAAAGTCAACTTTGCTGAACTCGAGTTCAGCAAAGTTGACTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032449.1-1702s1c1
Sequence:CCGGGCCTCAAGTTCTAAGGAGTCACTCGAGTGACTCCTTAGAACTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032449.1-4183s1c1
Sequence:CCGGGCTCAAGAACTGAGCTTTGTACTCGAGTACAAAGCTCAGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032449.1-2550s1c1
Sequence:CCGGGCTGGAGAATGAGTGTGAGATCTCGAGATCTCACACTCATTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177045
VALIDATED
CC2D1B MISSION shRNA Bacterial Glycerol Stock
coiled-coil and C2 domain containing 1B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177045.3-1798s21c1
Sequence:CCGGTCCCACTTACGAGTAGCTAAACTCGAGTTTAGCTACTCGTAAGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177045.3-1507s21c1
Sequence:CCGGGATTCAGTGGCAGCAACTTTACTCGAGTAAAGTTGCTGCCACTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177045.3-2901s21c1
Sequence:CCGGCCGTAACCGCTGCATAGTAATCTCGAGATTACTATGCAGCGGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177045.3-1372s21c1
Sequence:CCGGGATCGCATTGCCAAGCAATATCTCGAGATATTGCTTGGCAATGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177045.3-930s21c1
Sequence:CCGGCATTGCTCCCTTGCCTGATTCCTCGAGGAATCAGGCAAGGGAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177045.2-1373s1c1
Sequence:CCGGGATCGCATTGCCAAGCAATATCTCGAGATATTGCTTGGCAATGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177045.2-1520s1c1
Sequence:CCGGGCAACTTTAGCAACTGCCCAACTCGAGTTGGGCAGTTGCTAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177045
VALIDATED
CC2D1B MISSION shRNA shRNA Plasmid DNA
coiled-coil and C2 domain containing 1B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177045.3-1798s21c1
Sequence:CCGGTCCCACTTACGAGTAGCTAAACTCGAGTTTAGCTACTCGTAAGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177045.3-1507s21c1
Sequence:CCGGGATTCAGTGGCAGCAACTTTACTCGAGTAAAGTTGCTGCCACTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177045.3-2901s21c1
Sequence:CCGGCCGTAACCGCTGCATAGTAATCTCGAGATTACTATGCAGCGGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177045.3-1372s21c1
Sequence:CCGGGATCGCATTGCCAAGCAATATCTCGAGATATTGCTTGGCAATGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177045.3-930s21c1
Sequence:CCGGCATTGCTCCCTTGCCTGATTCCTCGAGGAATCAGGCAAGGGAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177045.2-1373s1c1
Sequence:CCGGGATCGCATTGCCAAGCAATATCTCGAGATATTGCTTGGCAATGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177045.2-1520s1c1
Sequence:CCGGGCAACTTTAGCAACTGCCCAACTCGAGTTGGGCAGTTGCTAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177045
VALIDATED
CC2D1B MISSION shRNA Lentiviral Transduction Particles
coiled-coil and C2 domain containing 1B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177045.3-1798s21c1
Sequence:CCGGTCCCACTTACGAGTAGCTAAACTCGAGTTTAGCTACTCGTAAGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177045.3-1507s21c1
Sequence:CCGGGATTCAGTGGCAGCAACTTTACTCGAGTAAAGTTGCTGCCACTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177045.3-2901s21c1
Sequence:CCGGCCGTAACCGCTGCATAGTAATCTCGAGATTACTATGCAGCGGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177045.3-1372s21c1
Sequence:CCGGGATCGCATTGCCAAGCAATATCTCGAGATATTGCTTGGCAATGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177045.3-930s21c1
Sequence:CCGGCATTGCTCCCTTGCCTGATTCCTCGAGGAATCAGGCAAGGGAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177045.2-1373s1c1
Sequence:CCGGGATCGCATTGCCAAGCAATATCTCGAGATATTGCTTGGCAATGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177045.2-1520s1c1
Sequence:CCGGGCAACTTTAGCAACTGCCCAACTCGAGTTGGGCAGTTGCTAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks