EMAIL THIS PAGE TO A FRIEND

CC2D2A

coiled-coil and C2 domain containing 2A

145 Gene Product Result for
Synonyms: JBTS9 MKS6
Gene ID:
Human(57545) Summary: This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(231214) coiled-coil and C2 domain containing 2A
Zebrafish(570250) coiled-coil and C2 domain containing 2A
domestic cat(101093267) coiled-coil and C2 domain containing 2A
dog(479086) coiled-coil and C2 domain containing 2A
cow(517240) coiled-coil and C2 domain containing 2A
Horse(100055932) coiled-coil and C2 domain containing 2A
Horse(100070917) coiled-coil and C2 domain containing 2A
chicken(422830) coiled-coil and C2 domain containing 2A
naked mole-rat(101722057) coiled-coil and C2 domain containing 2A
domestic guinea pig(100734220) coiled-coil and C2 domain containing 2A
sheep(101105915) coiled-coil and C2 domain containing 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080522 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080522 Rosetta Predictions human pricing
XM_106386 Rosetta Predictions human pricing
XM_928369 Rosetta Predictions human pricing
XM_932816 Rosetta Predictions human pricing
XM_932825 Rosetta Predictions human pricing
XM_932832 Rosetta Predictions human pricing
XM_932836 Rosetta Predictions human pricing
NM_172274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315657 predicted 2913
2 SASI_Hs02_00315658 predicted 2283
3 SASI_Hs02_00315659 predicted 2898
4 SASI_Hs02_00315660 predicted 2991
5 SASI_Hs02_00315661 predicted 309
6 SASI_Hs02_00315662 predicted 2297
7 SASI_Hs02_00315663 predicted 2681
8 SASI_Hs02_00315664 predicted 2977
9 SASI_Hs02_00315665 predicted 3499
10 SASI_Hs02_00315666 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_106386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295077 predicted 1489
2 SASI_Hs01_00295078 predicted 2197
3 SASI_Hs01_00295079 predicted 2821
4 SASI_Hs01_00295080 predicted 2910
5 SASI_Hs01_00295081 predicted 231
6 SASI_Hs01_00295082 predicted 2394
7 SASI_Hs01_00295083 predicted 2274
8 SASI_Hs01_00295084 predicted 2221
9 SASI_Hs01_00295085 predicted 2886
10 SASI_Hs01_00295086 predicted 3416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266288 predicted 1489
2 SASI_Hs01_00266289 predicted 2193
3 SASI_Hs01_00266290 predicted 2821
4 SASI_Hs01_00266291 predicted 2914
5 SASI_Hs01_00266292 predicted 229
6 SASI_Hs01_00266293 predicted 2387
7 SASI_Hs01_00266294 predicted 2276
8 SASI_Hs01_00266295 predicted 2212
9 SASI_Hs01_00266296 predicted 2890
10 SASI_Hs01_00266297 predicted 3416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275561 predicted 228
2 SASI_Hs01_00275562 predicted 265
3 SASI_Hs01_00275563 predicted 238
4 SASI_Hs01_00275564 predicted 256
5 SASI_Hs01_00275565 predicted 276
6 SASI_Hs01_00275566 predicted 228
7 SASI_Hs01_00275567 predicted 238
8 SASI_Hs01_00275568 predicted 262
9 SASI_Hs01_00275569 predicted 247
10 SASI_Hs01_00275570 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285038 predicted 335
2 SASI_Hs01_00285039 predicted 371
3 SASI_Hs01_00285040 predicted 227
4 SASI_Hs01_00285041 predicted 260
5 SASI_Hs01_00285042 predicted 212
6 SASI_Hs01_00285043 predicted 232
7 SASI_Hs01_00285044 predicted 360
8 SASI_Hs01_00285045 predicted 220
9 SASI_Hs01_00285046 predicted 233
10 SASI_Hs01_00285047 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275929 predicted 222
2 SASI_Hs01_00275930 predicted 213
3 SASI_Hs01_00275931 predicted 207
4 SASI_Hs01_00275932 predicted 171
5 SASI_Hs01_00275933 predicted 419
6 SASI_Hs01_00275934 predicted 1459
7 SASI_Hs01_00275935 predicted 1233
8 SASI_Hs01_00275936 predicted 1373
9 SASI_Hs01_00275937 predicted 1418
10 SASI_Hs01_00275938 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298584 predicted 2827
2 SASI_Hs01_00298585 predicted 1494
3 SASI_Hs01_00298586 predicted 2197
4 SASI_Hs01_00298587 predicted 2822
5 SASI_Hs01_00298588 predicted 2355
6 SASI_Hs01_00298589 predicted 225
7 SASI_Hs01_00298590 predicted 2390
8 SASI_Hs01_00298591 predicted 2280
9 SASI_Hs01_00298592 predicted 2213
10 SASI_Hs01_00298593 predicted 2601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113226 predicted 3827
2 SASI_Mm01_00113227 predicted 2843
3 SASI_Mm01_00113228 predicted 3211
4 SASI_Mm01_00113229 predicted 2679
5 SASI_Mm01_00113230 predicted 2537
6 SASI_Mm01_00113231 predicted 4098
7 SASI_Mm01_00113232 predicted 1534
8 SASI_Mm01_00113233 predicted 1527
9 SASI_Mm01_00113234 predicted 3949
10 SASI_Mm02_00343755 predicted 5145
11 SASI_Mm01_00113225 predicted 2672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172274
CC2D2A MISSION shRNA Bacterial Glycerol Stock
coiled-coil and C2 domain containing 2A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-1993s1c1
Sequence:CCGGGACCCGAAACTAGATGAGGATCTCGAGATCCTCATCTAGTTTCGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-879s1c1
Sequence:CCGGGTTCCGTGATTCTGTACGAAACTCGAGTTTCGTACAGAATCACGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-1291s1c1
Sequence:CCGGCCAAGATTCCTGGAAGATGAACTCGAGTTCATCTTCCAGGAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-4527s1c1
Sequence:CCGGGCTATGCAATTACTTTCTGTTCTCGAGAACAGAAAGTAATTGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-3957s1c1
Sequence:CCGGCCCATTTAGCACCATCTATTTCTCGAGAAATAGATGGTGCTAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172274.1-3982s21c1
Sequence:CCGGGCAAGGATTGATGGCACATTTCTCGAGAAATGTGCCATCAATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172274.1-939s21c1
Sequence:CCGGTGCAGAAGAGGCCTATAATTTCTCGAGAAATTATAGGCCTCTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172274
CC2D2A MISSION shRNA shRNA Plasmid DNA
coiled-coil and C2 domain containing 2A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-1993s1c1
Sequence:CCGGGACCCGAAACTAGATGAGGATCTCGAGATCCTCATCTAGTTTCGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-879s1c1
Sequence:CCGGGTTCCGTGATTCTGTACGAAACTCGAGTTTCGTACAGAATCACGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-1291s1c1
Sequence:CCGGCCAAGATTCCTGGAAGATGAACTCGAGTTCATCTTCCAGGAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-4527s1c1
Sequence:CCGGGCTATGCAATTACTTTCTGTTCTCGAGAACAGAAAGTAATTGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-3957s1c1
Sequence:CCGGCCCATTTAGCACCATCTATTTCTCGAGAAATAGATGGTGCTAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172274.1-3982s21c1
Sequence:CCGGGCAAGGATTGATGGCACATTTCTCGAGAAATGTGCCATCAATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172274.1-939s21c1
Sequence:CCGGTGCAGAAGAGGCCTATAATTTCTCGAGAAATTATAGGCCTCTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172274
CC2D2A MISSION shRNA Lentiviral Transduction Particles
coiled-coil and C2 domain containing 2A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-1993s1c1
Sequence:CCGGGACCCGAAACTAGATGAGGATCTCGAGATCCTCATCTAGTTTCGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-879s1c1
Sequence:CCGGGTTCCGTGATTCTGTACGAAACTCGAGTTTCGTACAGAATCACGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-1291s1c1
Sequence:CCGGCCAAGATTCCTGGAAGATGAACTCGAGTTCATCTTCCAGGAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-4527s1c1
Sequence:CCGGGCTATGCAATTACTTTCTGTTCTCGAGAACAGAAAGTAATTGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172274.1-3957s1c1
Sequence:CCGGCCCATTTAGCACCATCTATTTCTCGAGAAATAGATGGTGCTAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172274.1-3982s21c1
Sequence:CCGGGCAAGGATTGATGGCACATTTCTCGAGAAATGTGCCATCAATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172274.1-939s21c1
Sequence:CCGGTGCAGAAGAGGCCTATAATTTCTCGAGAAATTATAGGCCTCTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080522
VALIDATED
CC2D2A MISSION shRNA Bacterial Glycerol Stock
coiled-coil and C2 domain containing 2A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080522.2-4448s21c1
Sequence:CCGGTTGGGAGCAAGGTCGTTATTTCTCGAGAAATAACGACCTTGCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080522.2-1756s21c1
Sequence:CCGGCATTGCTTAAGACTATCATAACTCGAGTTATGATAGTCTTAAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080522.2-2397s21c1
Sequence:CCGGGTCAACTGGCCGGAGAGTTTACTCGAGTAAACTCTCCGGCCAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080522.2-882s21c1
Sequence:CCGGAGACATAGAGCGGGAACTAATCTCGAGATTAGTTCCCGCTCTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080522.2-1530s21c1
Sequence:CCGGGCCAAGCTGGCCCAGTTATATCTCGAGATATAACTGGGCCAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080522
VALIDATED
CC2D2A MISSION shRNA shRNA Plasmid DNA
coiled-coil and C2 domain containing 2A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080522.2-4448s21c1
Sequence:CCGGTTGGGAGCAAGGTCGTTATTTCTCGAGAAATAACGACCTTGCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080522.2-1756s21c1
Sequence:CCGGCATTGCTTAAGACTATCATAACTCGAGTTATGATAGTCTTAAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080522.2-2397s21c1
Sequence:CCGGGTCAACTGGCCGGAGAGTTTACTCGAGTAAACTCTCCGGCCAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080522.2-882s21c1
Sequence:CCGGAGACATAGAGCGGGAACTAATCTCGAGATTAGTTCCCGCTCTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080522.2-1530s21c1
Sequence:CCGGGCCAAGCTGGCCCAGTTATATCTCGAGATATAACTGGGCCAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080522
VALIDATED
CC2D2A MISSION shRNA Lentiviral Transduction Particles
coiled-coil and C2 domain containing 2A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080522.2-4448s21c1
Sequence:CCGGTTGGGAGCAAGGTCGTTATTTCTCGAGAAATAACGACCTTGCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080522.2-1756s21c1
Sequence:CCGGCATTGCTTAAGACTATCATAACTCGAGTTATGATAGTCTTAAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080522.2-2397s21c1
Sequence:CCGGGTCAACTGGCCGGAGAGTTTACTCGAGTAAACTCTCCGGCCAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080522.2-882s21c1
Sequence:CCGGAGACATAGAGCGGGAACTAATCTCGAGATTAGTTCCCGCTCTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080522.2-1530s21c1
Sequence:CCGGGCCAAGCTGGCCCAGTTATATCTCGAGATATAACTGGGCCAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks