EMAIL THIS PAGE TO A FRIEND

CC2D2B

coiled-coil and C2 domain containing 2B

146 Gene Product Result for
Synonyms: C10orf130 bA248J23.4
UniProtKB ID: Q6DHV5, A2A3E9, B4DYD4, E9PCC3, Q5VUS0
Gene ID:
Mouse(668310) coiled-coil and C2 domain containing 2B
Rat(294054) coiled-coil and C2 domain containing 2B
sheep(101110284) coiled-coil and C2 domain containing 2B
domestic guinea pig(100736082) coiled-coil and C2 domain containing 2B
naked mole-rat(101713033) coiled-coil and C2 domain containing 2B
cow(785845) coiled-coil and C2 domain containing 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001732 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001732 Rosetta Predictions human pricing
XM_001053681 Rosetta Predictions rat pricing
XM_220005 Rosetta Predictions rat pricing
XM_001000795 Rosetta Predictions mouse pricing
XM_994191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303912 predicted 1035
2 SASI_Hs02_00303913 predicted 234
3 SASI_Hs02_00303914 predicted 574
4 SASI_Hs02_00303915 predicted 738
5 SASI_Hs02_00303916 predicted 1158
6 SASI_Hs02_00303917 predicted 690
7 SASI_Hs02_00303918 predicted 934
8 SASI_Hs02_00303919 predicted 1070
9 SASI_Hs02_00303920 predicted 964
10 SASI_Hs02_00303921 predicted 1099
11 SASI_Hs01_00187366 predicted 1117
12 SASI_Hs01_00187367 predicted 893
13 SASI_Hs01_00187368 predicted 1141
14 SASI_Hs01_00187369 predicted 1074
15 SASI_Hs01_00187370 predicted 1257
16 SASI_Hs01_00187371 predicted 1029
17 SASI_Hs01_00187372 predicted 1281
18 SASI_Hs01_00187373 predicted 1087
19 SASI_Hs01_00187374 predicted 1108
20 SASI_Hs01_00187375 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273170 predicted 2806
2 SASI_Rn02_00273171 predicted 2668
3 SASI_Rn02_00273172 predicted 2006
4 SASI_Rn02_00273173 predicted 1967
5 SASI_Rn02_00273174 predicted 3489
6 SASI_Rn02_00273175 predicted 846
7 SASI_Rn02_00273176 predicted 392
8 SASI_Rn02_00273177 predicted 1379
9 SASI_Rn02_00273178 predicted 4147
10 SASI_Rn02_00273179 predicted 3048
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378905 predicted 3065
2 SASI_Rn02_00378906 predicted 2098
3 SASI_Rn02_00378907 predicted 3589
4 SASI_Rn02_00378908 predicted 1954
5 SASI_Rn02_00378909 predicted 1988
6 SASI_Rn02_00378910 predicted 4212
7 SASI_Rn02_00378911 predicted 820
8 SASI_Rn02_00378912 predicted 374
9 SASI_Rn02_00378913 predicted 1361
10 SASI_Rn02_00378914 predicted 3774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270816 predicted 388
2 SASI_Mm01_00270817 predicted 2381
3 SASI_Mm02_00354813 predicted 2111
4 SASI_Mm01_00270818 predicted 3595
5 SASI_Mm01_00270819 predicted 3679
6 SASI_Mm02_00354814 predicted 3908
7 SASI_Mm01_00270820 predicted 1713
8 SASI_Mm01_00270821 predicted 2071
9 SASI_Mm01_00270822 predicted 2077
10 SASI_Mm01_00270823 predicted 381
11 SASI_Mm01_00270824 predicted 3382
12 SASI_Mm01_00270825 predicted 2111
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451654 predicted 394
2 SASI_Mm02_00451655 predicted 2383
3 SASI_Mm02_00451656 predicted 2107
4 SASI_Mm02_00451657 predicted 3587
5 SASI_Mm02_00451658 predicted 3685
6 SASI_Mm02_00451659 predicted 1710
7 SASI_Mm02_00451660 predicted 2068
8 SASI_Mm02_00451661 predicted 2076
9 SASI_Mm02_00451662 predicted 387
10 SASI_Mm02_00451663 predicted 3385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001732
CC2D2B MISSION shRNA Bacterial Glycerol Stock
coiled-coil and C2 domain containing 2B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001732.3-497s21c1
Sequence:CCGGCACAATTCTAATGCAACATTTCTCGAGAAATGTTGCATTAGAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001732.3-1011s21c1
Sequence:CCGGTTGATGTACAGTCAATTATTGCTCGAGCAATAATTGACTGTACATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001732.3-1122s21c1
Sequence:CCGGTATTATCTGTGTGGGTCTATTCTCGAGAATAGACCCACACAGATAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001732.1-1472s1c1
Sequence:CCGGCGACCTAAACACCCAACACATCTCGAGATGTGTTGGGTGTTTAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001732.1-770s1c1
Sequence:CCGGGCAGTTTGTAAGTTTGTTGAACTCGAGTTCAACAAACTTACAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001732.1-740s1c1
Sequence:CCGGGAAATTGTATCTACAAGCCAACTCGAGTTGGCTTGTAGATACAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001732.1-599s1c1
Sequence:CCGGGTATCCGTTTCAGATGTAAATCTCGAGATTTACATCTGAAACGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001732.1-854s1c1
Sequence:CCGGGACGGAGATATTAAGATTCTTCTCGAGAAGAATCTTAATATCTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001732
CC2D2B MISSION shRNA shRNA Plasmid DNA
coiled-coil and C2 domain containing 2B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001732.3-497s21c1
Sequence:CCGGCACAATTCTAATGCAACATTTCTCGAGAAATGTTGCATTAGAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001732.3-1011s21c1
Sequence:CCGGTTGATGTACAGTCAATTATTGCTCGAGCAATAATTGACTGTACATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001732.3-1122s21c1
Sequence:CCGGTATTATCTGTGTGGGTCTATTCTCGAGAATAGACCCACACAGATAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001732.1-1472s1c1
Sequence:CCGGCGACCTAAACACCCAACACATCTCGAGATGTGTTGGGTGTTTAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001732.1-770s1c1
Sequence:CCGGGCAGTTTGTAAGTTTGTTGAACTCGAGTTCAACAAACTTACAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001732.1-740s1c1
Sequence:CCGGGAAATTGTATCTACAAGCCAACTCGAGTTGGCTTGTAGATACAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001732.1-599s1c1
Sequence:CCGGGTATCCGTTTCAGATGTAAATCTCGAGATTTACATCTGAAACGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001732.1-854s1c1
Sequence:CCGGGACGGAGATATTAAGATTCTTCTCGAGAAGAATCTTAATATCTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001732
CC2D2B MISSION shRNA Lentiviral Transduction Particles
coiled-coil and C2 domain containing 2B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001732.3-497s21c1
Sequence:CCGGCACAATTCTAATGCAACATTTCTCGAGAAATGTTGCATTAGAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001732.3-1011s21c1
Sequence:CCGGTTGATGTACAGTCAATTATTGCTCGAGCAATAATTGACTGTACATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001732.3-1122s21c1
Sequence:CCGGTATTATCTGTGTGGGTCTATTCTCGAGAATAGACCCACACAGATAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001732.1-1472s1c1
Sequence:CCGGCGACCTAAACACCCAACACATCTCGAGATGTGTTGGGTGTTTAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001732.1-770s1c1
Sequence:CCGGGCAGTTTGTAAGTTTGTTGAACTCGAGTTCAACAAACTTACAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001732.1-740s1c1
Sequence:CCGGGAAATTGTATCTACAAGCCAACTCGAGTTGGCTTGTAGATACAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001732.1-599s1c1
Sequence:CCGGGTATCCGTTTCAGATGTAAATCTCGAGATTTACATCTGAAACGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001732.1-854s1c1
Sequence:CCGGGACGGAGATATTAAGATTCTTCTCGAGAAGAATCTTAATATCTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks