EMAIL THIS PAGE TO A FRIEND

CCAR2

cell cycle and apoptosis regulator 2

140 Gene Product Result for
Synonyms: DBC-1 DBC1 KIAA1967 NET35 p30 DBC p30DBC
Gene ID:
Mouse(219158) cell cycle activator and apoptosis regulator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021174 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021174 Rosetta Predictions human pricing
NM_199205 Rosetta Predictions human pricing
XM_001001452 Rosetta Predictions mouse pricing
XM_985344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091456 predicted 912
2 SASI_Hs01_00091457 predicted 745
3 SASI_Hs01_00091458 predicted 1055
4 SASI_Hs01_00091459 predicted 1381
5 SASI_Hs01_00091460 predicted 594
6 SASI_Hs01_00091461 predicted 2090
7 SASI_Hs01_00091462 predicted 2943
8 SASI_Hs01_00091464 predicted 2219
9 SASI_Hs02_00354734 predicted 1381
10 SASI_Hs02_00354735 predicted 2218
11 SASI_Hs01_00091455 predicted 1031
12 SASI_Hs01_00091463 predicted 2334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010802 predicted 637
2 SASI_Hs01_00010803 predicted 457
3 SASI_Hs01_00010804 predicted 770
4 SASI_Hs01_00010805 predicted 1103
5 SASI_Hs01_00010806 predicted 307
6 SASI_Hs01_00010807 predicted 1813
7 SASI_Hs01_00010808 predicted 2666
8 SASI_Hs01_00010810 predicted 1935
9 SASI_Hs02_00372661 predicted 1099
10 SASI_Hs02_00372662 predicted 1941
11 SASI_Hs01_00010801 predicted 748
12 SASI_Hs01_00010809 predicted 2051
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284780 predicted 1646
2 SASI_Mm01_00284781 predicted 1760
3 SASI_Mm01_00284782 predicted 823
4 SASI_Mm02_00355142 predicted 3019
5 SASI_Mm01_00284783 predicted 1416
6 SASI_Mm01_00284784 predicted 1773
7 SASI_Mm01_00284785 predicted 974
8 SASI_Mm01_00284786 predicted 2740
9 SASI_Mm01_00284787 predicted 1603
10 SASI_Mm01_00284788 predicted 1666
11 SASI_Mm01_00284789 predicted 2624
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448747 predicted 1759
2 SASI_Mm02_00448748 predicted 2433
3 SASI_Mm02_00448749 predicted 822
4 SASI_Mm02_00448750 predicted 1419
5 SASI_Mm02_00448751 predicted 1773
6 SASI_Mm02_00448752 predicted 976
7 SASI_Mm02_00448753 predicted 2741
8 SASI_Mm02_00448754 predicted 1604
9 SASI_Mm02_00448755 predicted 1662
10 SASI_Mm02_00448756 predicted 2623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146055
VALIDATED
CCAR2 MISSION shRNA Bacterial Glycerol Stock
cell cycle and apoptosis regulator 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-3314s21c1
Sequence:CCGGACAAGGTCTAATGCCAATAAACTCGAGTTTATTGGCATTAGACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-788s21c1
Sequence:CCGGATGACTATGACTCGAAGAAACCTCGAGGTTTCTTCGAGTCATAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-876s21c1
Sequence:CCGGGGTTCATCTCACTCCCTATACCTCGAGGTATAGGGAGTGAGATGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-2167s21c1
Sequence:CCGGGATGATGGAGAGGACGAATTTCTCGAGAAATTCGTCCTCTCCATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-389s21c1
Sequence:CCGGCCAGCTTGCATGACTACTTTGCTCGAGCAAAGTAGTCATGCAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146055
VALIDATED
CCAR2 MISSION shRNA shRNA Plasmid DNA
cell cycle and apoptosis regulator 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-3314s21c1
Sequence:CCGGACAAGGTCTAATGCCAATAAACTCGAGTTTATTGGCATTAGACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-788s21c1
Sequence:CCGGATGACTATGACTCGAAGAAACCTCGAGGTTTCTTCGAGTCATAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-876s21c1
Sequence:CCGGGGTTCATCTCACTCCCTATACCTCGAGGTATAGGGAGTGAGATGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-2167s21c1
Sequence:CCGGGATGATGGAGAGGACGAATTTCTCGAGAAATTCGTCCTCTCCATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-389s21c1
Sequence:CCGGCCAGCTTGCATGACTACTTTGCTCGAGCAAAGTAGTCATGCAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146055
VALIDATED
CCAR2 MISSION shRNA Lentiviral Transduction Particles
cell cycle and apoptosis regulator 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-3314s21c1
Sequence:CCGGACAAGGTCTAATGCCAATAAACTCGAGTTTATTGGCATTAGACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-788s21c1
Sequence:CCGGATGACTATGACTCGAAGAAACCTCGAGGTTTCTTCGAGTCATAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-876s21c1
Sequence:CCGGGGTTCATCTCACTCCCTATACCTCGAGGTATAGGGAGTGAGATGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-2167s21c1
Sequence:CCGGGATGATGGAGAGGACGAATTTCTCGAGAAATTCGTCCTCTCCATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146055.3-389s21c1
Sequence:CCGGCCAGCTTGCATGACTACTTTGCTCGAGCAAAGTAGTCATGCAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021174
VALIDATED
CCAR2 MISSION shRNA Bacterial Glycerol Stock
cell cycle and apoptosis regulator 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-585s21c1
Sequence:CCGGCGGGTCTTCACTGGTATTGTTCTCGAGAACAATACCAGTGAAGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-1597s21c1
Sequence:CCGGGCATTGATTTGAGCGGCTGTACTCGAGTACAGCCGCTCAAATCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-1125s21c1
Sequence:CCGGCCCATCTGTGACTTCCTAGAACTCGAGTTCTAGGAAGTCACAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-1443s21c1
Sequence:CCGGCCTCTGAAGCAGATTAAGTTTCTCGAGAAACTTAATCTGCTTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-2003s21c1
Sequence:CCGGGCCAAAGGAAAGGATCTCTTTCTCGAGAAAGAGATCCTTTCCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-1443s1c1
Sequence:CCGGCCTCTGAAGCAGATTAAGTTTCTCGAGAAACTTAATCTGCTTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-1597s1c1
Sequence:CCGGGCATTGATTTGAGCGGCTGTACTCGAGTACAGCCGCTCAAATCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-2003s1c1
Sequence:CCGGGCCAAAGGAAAGGATCTCTTTCTCGAGAAAGAGATCCTTTCCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-585s1c1
Sequence:CCGGCGGGTCTTCACTGGTATTGTTCTCGAGAACAATACCAGTGAAGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-1125s1c1
Sequence:CCGGCCCATCTGTGACTTCCTAGAACTCGAGTTCTAGGAAGTCACAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021174
VALIDATED
CCAR2 MISSION shRNA shRNA Plasmid DNA
cell cycle and apoptosis regulator 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-585s21c1
Sequence:CCGGCGGGTCTTCACTGGTATTGTTCTCGAGAACAATACCAGTGAAGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-1597s21c1
Sequence:CCGGGCATTGATTTGAGCGGCTGTACTCGAGTACAGCCGCTCAAATCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-1125s21c1
Sequence:CCGGCCCATCTGTGACTTCCTAGAACTCGAGTTCTAGGAAGTCACAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-1443s21c1
Sequence:CCGGCCTCTGAAGCAGATTAAGTTTCTCGAGAAACTTAATCTGCTTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-2003s21c1
Sequence:CCGGGCCAAAGGAAAGGATCTCTTTCTCGAGAAAGAGATCCTTTCCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-1443s1c1
Sequence:CCGGCCTCTGAAGCAGATTAAGTTTCTCGAGAAACTTAATCTGCTTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-1597s1c1
Sequence:CCGGGCATTGATTTGAGCGGCTGTACTCGAGTACAGCCGCTCAAATCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-2003s1c1
Sequence:CCGGGCCAAAGGAAAGGATCTCTTTCTCGAGAAAGAGATCCTTTCCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-585s1c1
Sequence:CCGGCGGGTCTTCACTGGTATTGTTCTCGAGAACAATACCAGTGAAGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-1125s1c1
Sequence:CCGGCCCATCTGTGACTTCCTAGAACTCGAGTTCTAGGAAGTCACAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021174
VALIDATED
CCAR2 MISSION shRNA Lentiviral Transduction Particles
cell cycle and apoptosis regulator 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-585s21c1
Sequence:CCGGCGGGTCTTCACTGGTATTGTTCTCGAGAACAATACCAGTGAAGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-1597s21c1
Sequence:CCGGGCATTGATTTGAGCGGCTGTACTCGAGTACAGCCGCTCAAATCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-1125s21c1
Sequence:CCGGCCCATCTGTGACTTCCTAGAACTCGAGTTCTAGGAAGTCACAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-1443s21c1
Sequence:CCGGCCTCTGAAGCAGATTAAGTTTCTCGAGAAACTTAATCTGCTTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021174.4-2003s21c1
Sequence:CCGGGCCAAAGGAAAGGATCTCTTTCTCGAGAAAGAGATCCTTTCCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-1443s1c1
Sequence:CCGGCCTCTGAAGCAGATTAAGTTTCTCGAGAAACTTAATCTGCTTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-1597s1c1
Sequence:CCGGGCATTGATTTGAGCGGCTGTACTCGAGTACAGCCGCTCAAATCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-2003s1c1
Sequence:CCGGGCCAAAGGAAAGGATCTCTTTCTCGAGAAAGAGATCCTTTCCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-585s1c1
Sequence:CCGGCGGGTCTTCACTGGTATTGTTCTCGAGAACAATACCAGTGAAGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021174.4-1125s1c1
Sequence:CCGGCCCATCTGTGACTTCCTAGAACTCGAGTTCTAGGAAGTCACAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)