EMAIL THIS PAGE TO A FRIEND

CCBE1

collagen and calcium binding EGF domains 1

58 Gene Product Result for
UniProtKB ID: Q6UXH8, Q6MZX5, Q86SS2, Q8TF19
Gene ID:
Human(147372) Summary: This gene is thought to function in extracellular matrix remodeling and migration. It is predominantly expressed in the ovary, but down regulated in ovarian cancer cell lines and primary carcinomas, suggesting its role as a tumour suppressor. Mutations in this gene have been associated with Hennekam lymphangiectasia-lymphedema syndrome, a generalized lymphatic dysplasia in humans. [provided by RefSeq, Mar 2010]
Mouse(320924) collagen and calcium binding EGF domains 1
Rat(361341) collagen and calcium binding EGF domains 1
Zebrafish(555629) collagen and calcium binding EGF domains 1
chicken(770043) collagen and calcium binding EGF domains 1
cow(534569) collagen and calcium binding EGF domains 1
dog(610092) collagen and calcium binding EGF domains 1
domestic cat(101089652) collagen and calcium binding EGF domains 1
domestic guinea pig(100727972) collagen and calcium binding EGF domains 1
sheep(101117553) collagen and calcium binding EGF domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133459 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133459 Rosetta Predictions human pricing
XM_001065428 Rosetta Predictions rat pricing
XM_341624 Rosetta Predictions rat pricing
NM_178793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232964 predicted 236
2 SASI_Hs01_00232965 predicted 570
3 SASI_Hs01_00232966 predicted 1657
4 SASI_Hs01_00232967 predicted 1659
5 SASI_Hs01_00232968 predicted 366
6 SASI_Hs01_00232969 predicted 1639
7 SASI_Hs01_00232970 predicted 1015
8 SASI_Hs01_00232971 predicted 1036
9 SASI_Hs01_00232972 predicted 368
10 SASI_Hs01_00232973 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065428 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314084 predicted 1514
2 SASI_Rn02_00314085 predicted 783
3 SASI_Rn02_00314086 predicted 870
4 SASI_Rn02_00314087 predicted 1779
5 SASI_Rn02_00314088 predicted 280
6 SASI_Rn02_00314089 predicted 608
7 SASI_Rn02_00314090 predicted 811
8 SASI_Rn02_00314091 predicted 313
9 SASI_Rn02_00314092 predicted 966
10 SASI_Rn02_00314093 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393149 predicted 214
2 SASI_Rn02_00393150 predicted 218
3 SASI_Rn02_00393151 predicted 225
4 SASI_Rn02_00393152 predicted 271
5 SASI_Rn02_00393153 predicted 212
6 SASI_Rn02_00393154 predicted 234
7 SASI_Rn02_00393155 predicted 251
8 SASI_Rn02_00393156 predicted 225
9 SASI_Rn02_00393157 predicted 251
10 SASI_Rn02_00393158 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060617 predicted 623
2 SASI_Mm01_00060618 predicted 310
3 SASI_Mm01_00060619 predicted 393
4 SASI_Mm01_00060620 predicted 304
5 SASI_Mm01_00060621 predicted 431
6 SASI_Mm01_00060622 predicted 467
7 SASI_Mm01_00060623 predicted 435
8 SASI_Mm01_00060624 predicted 1116
9 SASI_Mm01_00060625 predicted 338
10 SASI_Mm01_00060626 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133459
CCBE1 MISSION shRNA Bacterial Glycerol Stock
collagen and calcium binding EGF domains 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-337s1c1
Sequence:CCGGCCGAGTGCTGTGTACTTGTTACTCGAGTAACAAGTACACAGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-1030s1c1
Sequence:CCGGGCTACTTATGCTGGCTGACATCTCGAGATGTCAGCCAGCATAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-400s1c1
Sequence:CCGGGAAGCCATACTGTCTGGATATCTCGAGATATCCAGACAGTATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-1117s1c1
Sequence:CCGGGTTCCCTTTACCTCAGGAATTCTCGAGAATTCCTGAGGTAAAGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-571s1c1
Sequence:CCGGCCATGAGAAGTCTGAGAACATCTCGAGATGTTCTCAGACTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133459.3-1484s21c1
Sequence:CCGGGAGGGAGTGAATGATTGATTTCTCGAGAAATCAATCATTCACTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133459.3-1717s21c1
Sequence:CCGGGACCATAACTCCTCTAGTATCCTCGAGGATACTAGAGGAGTTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133459.3-1592s21c1
Sequence:CCGGTACTCTCACAGTGTCTTAAATCTCGAGATTTAAGACACTGTGAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133459.3-748s21c1
Sequence:CCGGAGCTGACCTGGGCAAGTATATCTCGAGATATACTTGCCCAGGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133459.3-328s21c1
Sequence:CCGGCCCAGAAGATTACGACGTTTGCTCGAGCAAACGTCGTAATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133459
CCBE1 MISSION shRNA shRNA Plasmid DNA
collagen and calcium binding EGF domains 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-337s1c1
Sequence:CCGGCCGAGTGCTGTGTACTTGTTACTCGAGTAACAAGTACACAGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-1030s1c1
Sequence:CCGGGCTACTTATGCTGGCTGACATCTCGAGATGTCAGCCAGCATAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-400s1c1
Sequence:CCGGGAAGCCATACTGTCTGGATATCTCGAGATATCCAGACAGTATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-1117s1c1
Sequence:CCGGGTTCCCTTTACCTCAGGAATTCTCGAGAATTCCTGAGGTAAAGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-571s1c1
Sequence:CCGGCCATGAGAAGTCTGAGAACATCTCGAGATGTTCTCAGACTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133459.3-1484s21c1
Sequence:CCGGGAGGGAGTGAATGATTGATTTCTCGAGAAATCAATCATTCACTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133459.3-1717s21c1
Sequence:CCGGGACCATAACTCCTCTAGTATCCTCGAGGATACTAGAGGAGTTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133459.3-1592s21c1
Sequence:CCGGTACTCTCACAGTGTCTTAAATCTCGAGATTTAAGACACTGTGAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133459.3-748s21c1
Sequence:CCGGAGCTGACCTGGGCAAGTATATCTCGAGATATACTTGCCCAGGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133459.3-328s21c1
Sequence:CCGGCCCAGAAGATTACGACGTTTGCTCGAGCAAACGTCGTAATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133459
CCBE1 MISSION shRNA Lentiviral Transduction Particles
collagen and calcium binding EGF domains 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-337s1c1
Sequence:CCGGCCGAGTGCTGTGTACTTGTTACTCGAGTAACAAGTACACAGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-1030s1c1
Sequence:CCGGGCTACTTATGCTGGCTGACATCTCGAGATGTCAGCCAGCATAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-400s1c1
Sequence:CCGGGAAGCCATACTGTCTGGATATCTCGAGATATCCAGACAGTATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-1117s1c1
Sequence:CCGGGTTCCCTTTACCTCAGGAATTCTCGAGAATTCCTGAGGTAAAGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133459.1-571s1c1
Sequence:CCGGCCATGAGAAGTCTGAGAACATCTCGAGATGTTCTCAGACTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133459.3-1484s21c1
Sequence:CCGGGAGGGAGTGAATGATTGATTTCTCGAGAAATCAATCATTCACTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133459.3-1717s21c1
Sequence:CCGGGACCATAACTCCTCTAGTATCCTCGAGGATACTAGAGGAGTTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133459.3-1592s21c1
Sequence:CCGGTACTCTCACAGTGTCTTAAATCTCGAGATTTAAGACACTGTGAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133459.3-748s21c1
Sequence:CCGGAGCTGACCTGGGCAAGTATATCTCGAGATATACTTGCCCAGGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133459.3-328s21c1
Sequence:CCGGCCCAGAAGATTACGACGTTTGCTCGAGCAAACGTCGTAATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178793
VALIDATED
CCBE1 MISSION shRNA Bacterial Glycerol Stock
collagen and calcium binding EGF domains 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178793.2-2842s1c1
Sequence:CCGGCCCAGTTAGAAAGGCAGGATTCTCGAGAATCCTGCCTTTCTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178793.2-401s1c1
Sequence:CCGGGAGACCGTACTGTCTGGATATCTCGAGATATCCAGACAGTACGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178793.2-710s1c1
Sequence:CCGGCAAGTATGTCAATGGTGACAACTCGAGTTGTCACCATTGACATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178793.2-267s1c1
Sequence:CCGGCAGTGTATTCCAGAAGATTATCTCGAGATAATCTTCTGGAATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178793.2-893s1c1
Sequence:CCGGCCCTGACCTGTCTCATATTAACTCGAGTTAATATGAGACAGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178793
VALIDATED
CCBE1 MISSION shRNA shRNA Plasmid DNA
collagen and calcium binding EGF domains 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178793.2-2842s1c1
Sequence:CCGGCCCAGTTAGAAAGGCAGGATTCTCGAGAATCCTGCCTTTCTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178793.2-401s1c1
Sequence:CCGGGAGACCGTACTGTCTGGATATCTCGAGATATCCAGACAGTACGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178793.2-710s1c1
Sequence:CCGGCAAGTATGTCAATGGTGACAACTCGAGTTGTCACCATTGACATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178793.2-267s1c1
Sequence:CCGGCAGTGTATTCCAGAAGATTATCTCGAGATAATCTTCTGGAATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178793.2-893s1c1
Sequence:CCGGCCCTGACCTGTCTCATATTAACTCGAGTTAATATGAGACAGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178793
VALIDATED
CCBE1 MISSION shRNA Lentiviral Transduction Particles
collagen and calcium binding EGF domains 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178793.2-2842s1c1
Sequence:CCGGCCCAGTTAGAAAGGCAGGATTCTCGAGAATCCTGCCTTTCTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178793.2-401s1c1
Sequence:CCGGGAGACCGTACTGTCTGGATATCTCGAGATATCCAGACAGTACGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178793.2-710s1c1
Sequence:CCGGCAAGTATGTCAATGGTGACAACTCGAGTTGTCACCATTGACATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178793.2-267s1c1
Sequence:CCGGCAGTGTATTCCAGAAGATTATCTCGAGATAATCTTCTGGAATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178793.2-893s1c1
Sequence:CCGGCCCTGACCTGTCTCATATTAACTCGAGTTAATATGAGACAGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks