EMAIL THIS PAGE TO A FRIEND

CCBL1

cysteine conjugate-beta lyase, cytoplasmic

Synonyms: GTK KAT1 KATI
UniProtKB ID: Q16773, Q5T275, Q8N191
Gene ID:
Human(883) Summary: This gene encodes a cytosolic enzyme that is responsible for the metabolism of cysteine conjugates of certain halogenated alkenes and alkanes. This metabolism can form reactive metabolites leading to nephrotoxicity and neurotoxicity. Increased levels of this enzyme have been linked to schizophrenia. Multiple transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(70266) cysteine conjugate-beta lyase 1
Rat(311844) cysteine conjugate-beta lyase, cytoplasmic
sheep(101117485) cysteine conjugate-beta lyase, cytoplasmic
domestic guinea pig(100713469) cysteine conjugate-beta lyase, cytoplasmic
naked mole-rat(101714047) cysteine conjugate-beta lyase, cytoplasmic
Zebrafish(791592) cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)
chicken(417202) cysteine conjugate-beta lyase, cytoplasmic
dog(491310) cysteine conjugate-beta lyase, cytoplasmic
Horse(100070151) cysteine conjugate-beta lyase, cytoplasmic
cow(528582) cysteine conjugate-beta lyase, cytoplasmic
domestic cat(101082605) cysteine conjugate-beta lyase, cytoplasmic
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301767 Anti-CCBL1 affinity isolated antibody human, rat
immunohistochemistry, western blot pricing
C4747 Anti-CCBL1 (408-422) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C4622 Anti-CCBL1 (7-20) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW21989A Anti-CCBL1 (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
GW21989B Anti-CCBL1 (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1405569 Anti-CCBL1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA021176 Anti-CCBL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunofluorescence, immunohistochemistry pricing
HPA021177 Anti-CCBL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunofluorescence, immunohistochemistry pricing
HPA027736 Anti-CCBL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1402141 Monoclonal Anti-CCBL1 antibody produced in mouse clone 1B12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004059 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157871 MISSION® esiRNA esiRNA human CCBL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122671 Rosetta Predictions human pricing
NM_001122672 Rosetta Predictions human pricing
NM_004059 Rosetta Predictions human pricing
NM_001013164 Rosetta Predictions rat pricing
NM_172404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327176 predicted 1166
2 SASI_Hs02_00327177 predicted 1262
3 SASI_Hs02_00327178 predicted 962
4 SASI_Hs02_00327179 predicted 786
5 SASI_Hs02_00327180 predicted 778
6 SASI_Hs02_00327181 predicted 959
7 SASI_Hs02_00327182 predicted 1505
8 SASI_Hs02_00327183 predicted 1359
9 SASI_Hs02_00327184 predicted 1675
10 SASI_Hs02_00327185 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327186 predicted 1017
2 SASI_Hs02_00327187 predicted 1122
3 SASI_Hs02_00327188 predicted 813
4 SASI_Hs02_00327189 predicted 649
5 SASI_Hs02_00327190 predicted 625
6 SASI_Hs02_00327191 predicted 810
7 SASI_Hs02_00327192 predicted 1360
8 SASI_Hs02_00327193 predicted 1210
9 SASI_Hs02_00327194 predicted 1527
10 SASI_Hs02_00327195 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336834 predicted 1174
2 SASI_Hs02_00336835 predicted 1271
3 SASI_Hs01_00122222 predicted 961
4 SASI_Hs02_00336836 predicted 794
5 SASI_Hs02_00336837 predicted 782
6 SASI_Hs02_00336838 predicted 964
7 SASI_Hs02_00336839 predicted 1512
8 SASI_Hs01_00122225 predicted 1365
9 SASI_Hs02_00336840 predicted 1685
10 SASI_Hs02_00336841 predicted 1183
11 SASI_Hs01_00122219 predicted 440
12 SASI_Hs01_00122220 predicted 695
13 SASI_Hs01_00122221 predicted 356
14 SASI_Hs01_00122223 predicted 357
15 SASI_Hs01_00122224 predicted 534
16 SASI_Hs01_00122226 predicted 378
17 SASI_Hs01_00122227 predicted 316
18 SASI_Hs01_00122228 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094220 predicted 224
2 SASI_Rn01_00094221 predicted 296
3 SASI_Rn01_00094222 predicted 642
4 SASI_Rn01_00094223 predicted 266
5 SASI_Rn01_00094224 predicted 318
6 SASI_Rn01_00094225 predicted 879
7 SASI_Rn02_00200905 predicted 214
8 SASI_Rn01_00094227 predicted 473
9 SASI_Rn01_00094228 predicted 471
10 SASI_Rn02_00200906 predicted 1104
11 SASI_Rn01_00094226 predicted 778
12 SASI_Rn01_00094229 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175693 predicted 490
2 SASI_Mm01_00175694 predicted 403
3 SASI_Mm01_00175695 predicted 1052
4 SASI_Mm01_00175696 predicted 819
5 SASI_Mm02_00343867 predicted 884
6 SASI_Mm01_00175697 predicted 1281
7 SASI_Mm01_00175698 predicted 1452
8 SASI_Mm01_00175699 predicted 1341
9 SASI_Mm01_00175700 predicted 437
10 SASI_Mm01_00175702 predicted 768
11 SASI_Mm01_00175701 predicted 1622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004059
CCBL1 MISSION shRNA Bacterial Glycerol Stock
cysteine conjugate-beta lyase, cytoplasmic
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004059.4-348s21c1
Sequence:CCGGAGTGGAGACTTCATGCTTAACCTCGAGGTTAAGCATGAAGTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004059.4-1355s21c1
Sequence:CCGGGAAGCACTTTGACCACTATATCTCGAGATATAGTGGTCAAAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004059.4-301s21c1
Sequence:CCGGATTTCCCACCACCAGACTTTGCTCGAGCAAAGTCTGGTGGTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-349s1c1
Sequence:CCGGGTACACCAAGACATTTGGTTACTCGAGTAACCAAATGTCTTGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-670s1c1
Sequence:CCGGCAAATTCACATCACGCACCAACTCGAGTTGGTGCGTGATGTGAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-379s1c1
Sequence:CCGGGACGAAGATCCTGGCAAGTTTCTCGAGAAACTTGCCAGGATCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-857s1c1
Sequence:CCGGGCAGCTGTTCTGTTCGGCCTTCTCGAGAAGGCCGAACAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-784s1c1
Sequence:CCGGCGTGGTGTGTATCACTGATGACTCGAGTCATCAGTGATACACACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004059
CCBL1 MISSION shRNA shRNA Plasmid DNA
cysteine conjugate-beta lyase, cytoplasmic
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004059.4-348s21c1
Sequence:CCGGAGTGGAGACTTCATGCTTAACCTCGAGGTTAAGCATGAAGTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004059.4-1355s21c1
Sequence:CCGGGAAGCACTTTGACCACTATATCTCGAGATATAGTGGTCAAAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004059.4-301s21c1
Sequence:CCGGATTTCCCACCACCAGACTTTGCTCGAGCAAAGTCTGGTGGTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-349s1c1
Sequence:CCGGGTACACCAAGACATTTGGTTACTCGAGTAACCAAATGTCTTGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-670s1c1
Sequence:CCGGCAAATTCACATCACGCACCAACTCGAGTTGGTGCGTGATGTGAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-379s1c1
Sequence:CCGGGACGAAGATCCTGGCAAGTTTCTCGAGAAACTTGCCAGGATCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-857s1c1
Sequence:CCGGGCAGCTGTTCTGTTCGGCCTTCTCGAGAAGGCCGAACAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-784s1c1
Sequence:CCGGCGTGGTGTGTATCACTGATGACTCGAGTCATCAGTGATACACACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004059
CCBL1 MISSION shRNA Lentiviral Transduction Particles
cysteine conjugate-beta lyase, cytoplasmic
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004059.4-348s21c1
Sequence:CCGGAGTGGAGACTTCATGCTTAACCTCGAGGTTAAGCATGAAGTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004059.4-1355s21c1
Sequence:CCGGGAAGCACTTTGACCACTATATCTCGAGATATAGTGGTCAAAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004059.4-301s21c1
Sequence:CCGGATTTCCCACCACCAGACTTTGCTCGAGCAAAGTCTGGTGGTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-349s1c1
Sequence:CCGGGTACACCAAGACATTTGGTTACTCGAGTAACCAAATGTCTTGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-670s1c1
Sequence:CCGGCAAATTCACATCACGCACCAACTCGAGTTGGTGCGTGATGTGAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-379s1c1
Sequence:CCGGGACGAAGATCCTGGCAAGTTTCTCGAGAAACTTGCCAGGATCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-857s1c1
Sequence:CCGGGCAGCTGTTCTGTTCGGCCTTCTCGAGAAGGCCGAACAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004059.3-784s1c1
Sequence:CCGGCGTGGTGTGTATCACTGATGACTCGAGTCATCAGTGATACACACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172404
CCBL1 MISSION shRNA Bacterial Glycerol Stock
cysteine conjugate-beta lyase, cytoplasmic
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172404.2-1586s1c1
Sequence:CCGGGCTGTGCCTTATCACAGAGATCTCGAGATCTCTGTGATAAGGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172404.2-834s1c1
Sequence:CCGGTCTGGGAAAGGTATTCTCTAACTCGAGTTAGAGAATACCTTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172404.2-1345s1c1
Sequence:CCGGGCTATGGATGAGCCCTATGATCTCGAGATCATAGGGCTCATCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172404.2-501s1c1
Sequence:CCGGCCTGGCAAGTTTCTTTGGCAACTCGAGTTGCCAAAGAAACTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172404
CCBL1 MISSION shRNA shRNA Plasmid DNA
cysteine conjugate-beta lyase, cytoplasmic
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172404.2-1586s1c1
Sequence:CCGGGCTGTGCCTTATCACAGAGATCTCGAGATCTCTGTGATAAGGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172404.2-834s1c1
Sequence:CCGGTCTGGGAAAGGTATTCTCTAACTCGAGTTAGAGAATACCTTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172404.2-1345s1c1
Sequence:CCGGGCTATGGATGAGCCCTATGATCTCGAGATCATAGGGCTCATCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172404.2-501s1c1
Sequence:CCGGCCTGGCAAGTTTCTTTGGCAACTCGAGTTGCCAAAGAAACTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172404
CCBL1 MISSION shRNA Lentiviral Transduction Particles
cysteine conjugate-beta lyase, cytoplasmic
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172404.2-1586s1c1
Sequence:CCGGGCTGTGCCTTATCACAGAGATCTCGAGATCTCTGTGATAAGGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172404.2-834s1c1
Sequence:CCGGTCTGGGAAAGGTATTCTCTAACTCGAGTTAGAGAATACCTTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172404.2-1345s1c1
Sequence:CCGGGCTATGGATGAGCCCTATGATCTCGAGATCATAGGGCTCATCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172404.2-501s1c1
Sequence:CCGGCCTGGCAAGTTTCTTTGGCAACTCGAGTTGCCAAAGAAACTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks