EMAIL THIS PAGE TO A FRIEND

CCBL2

cysteine conjugate-beta lyase 2

Synonyms: KAT3 KATIII RP4-531M19.2
Gene ID:
Human(56267) Summary: This gene encodes an aminotransferase that transaminates kynurenine to form kynurenic acid. Kynurenic acid is a metabolite of tryptophan. Multiple alternatively spliced transcript variants that encode different proteins have been described for this gene. This gene shares 5' exon structure with the RNA binding motif protein, X-linked-like 1 locus on chromosome 1, but the coding sequences are non-overlapping. [provided by RefSeq, Jun 2009]
Mouse(229905) cysteine conjugate-beta lyase 2
Zebrafish(393315) cysteine conjugate-beta lyase 2
cow(508712) cysteine conjugate-beta lyase 2
Horse(100052141) cysteine conjugate-beta lyase 2
domestic cat(101082171) cysteine conjugate-beta lyase 2
dog(479959) cysteine conjugate-beta lyase 2
chicken(424517) cysteine conjugate-beta lyase 2
naked mole-rat(101701445) cysteine conjugate-beta lyase 2
domestic guinea pig(100724524) cysteine conjugate-beta lyase 2
sheep(101119265) cysteine conjugate-beta lyase 2
Domestic Rabbit(100358799) cysteine conjugate-beta lyase 2
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019610 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001008662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008662 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008661 Rosetta Predictions human pricing
NM_001008662 Rosetta Predictions human pricing
NM_019610 Rosetta Predictions human pricing
NM_173763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231301 predicted 929
2 SASI_Hs02_00305519 predicted 1338
3 SASI_Hs01_00231303 predicted 989
4 SASI_Hs02_00305520 predicted 603
5 SASI_Hs01_00231305 predicted 1121
6 SASI_Hs01_00231306 predicted 1234
7 SASI_Hs01_00231307 predicted 662
8 SASI_Hs01_00231308 predicted 626
9 SASI_Hs02_00305521 predicted 780
10 SASI_Hs01_00231309 predicted 814
11 SASI_Hs01_00231302 predicted 1257
12 SASI_Hs01_00231304 predicted 792
13 SASI_Hs01_00231310 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049884 predicted 830
2 SASI_Hs02_00305522 predicted 1237
3 SASI_Hs01_00049886 predicted 891
4 SASI_Hs02_00305523 predicted 503
5 SASI_Hs01_00049888 predicted 1022
6 SASI_Hs01_00049889 predicted 1139
7 SASI_Hs01_00049890 predicted 565
8 SASI_Hs01_00049891 predicted 527
9 SASI_Hs02_00305524 predicted 682
10 SASI_Hs01_00049892 predicted 714
11 SASI_Hs01_00049885 predicted 1161
12 SASI_Hs01_00049887 predicted 694
13 SASI_Hs01_00049893 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174549 predicted 1921
2 SASI_Hs01_00174550 predicted 1924
3 SASI_Hs01_00174551 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180017 predicted 249
2 SASI_Mm02_00345417 predicted 702
3 SASI_Mm01_00180018 predicted 550
4 SASI_Mm01_00180019 predicted 1088
5 SASI_Mm01_00180020 predicted 497
6 SASI_Mm01_00180022 predicted 676
7 SASI_Mm01_00180023 predicted 1164
8 SASI_Mm02_00345418 predicted 990
9 SASI_Mm02_00345419 predicted 242
10 SASI_Mm01_00180025 predicted 1207
11 SASI_Mm01_00180021 predicted 1461
12 SASI_Mm01_00180024 predicted 909
13 SASI_Mm01_00180026 predicted 1009
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019610
CCBL2 MISSION shRNA Bacterial Glycerol Stock
cysteine conjugate-beta lyase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-1264s1c1
Sequence:CCGGGCCGAAGTGATCTCTACTCAACTCGAGTTGAGTAGAGATCACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-874s1c1
Sequence:CCGGCCTCTCGTAGAGATGTTTATTCTCGAGAATAAACATCTCTACGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-1034s1c1
Sequence:CCGGTGACTATCCATCAAGAGGCTACTCGAGTAGCCTCTTGATGGATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-302s1c1
Sequence:CCGGGCTCTTCATTGGTGGGCTTAACTCGAGTTAAGCCCACCAATGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-526s1c1
Sequence:CCGGCCACCAAACCATCATTTGAAACTCGAGTTTCAAATGATGGTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019610.3-1193s1c1
Sequence:CCGGCACCACCACCACGAGATTATACTCGAGTATAATCTCGTGGTGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179861    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019610.3-2278s1c1
Sequence:CCGGCCTCCCACAATAAGACCATTTCTCGAGAAATGGTCTTATTGTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019610
CCBL2 MISSION shRNA shRNA Plasmid DNA
cysteine conjugate-beta lyase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-1264s1c1
Sequence:CCGGGCCGAAGTGATCTCTACTCAACTCGAGTTGAGTAGAGATCACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-874s1c1
Sequence:CCGGCCTCTCGTAGAGATGTTTATTCTCGAGAATAAACATCTCTACGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-1034s1c1
Sequence:CCGGTGACTATCCATCAAGAGGCTACTCGAGTAGCCTCTTGATGGATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-302s1c1
Sequence:CCGGGCTCTTCATTGGTGGGCTTAACTCGAGTTAAGCCCACCAATGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-526s1c1
Sequence:CCGGCCACCAAACCATCATTTGAAACTCGAGTTTCAAATGATGGTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019610.3-1193s1c1
Sequence:CCGGCACCACCACCACGAGATTATACTCGAGTATAATCTCGTGGTGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179861    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019610.3-2278s1c1
Sequence:CCGGCCTCCCACAATAAGACCATTTCTCGAGAAATGGTCTTATTGTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019610
CCBL2 MISSION shRNA Lentiviral Transduction Particles
cysteine conjugate-beta lyase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-1264s1c1
Sequence:CCGGGCCGAAGTGATCTCTACTCAACTCGAGTTGAGTAGAGATCACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-874s1c1
Sequence:CCGGCCTCTCGTAGAGATGTTTATTCTCGAGAATAAACATCTCTACGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-1034s1c1
Sequence:CCGGTGACTATCCATCAAGAGGCTACTCGAGTAGCCTCTTGATGGATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-302s1c1
Sequence:CCGGGCTCTTCATTGGTGGGCTTAACTCGAGTTAAGCCCACCAATGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019610.2-526s1c1
Sequence:CCGGCCACCAAACCATCATTTGAAACTCGAGTTTCAAATGATGGTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019610.3-1193s1c1
Sequence:CCGGCACCACCACCACGAGATTATACTCGAGTATAATCTCGTGGTGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179861    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019610.3-2278s1c1
Sequence:CCGGCCTCCCACAATAAGACCATTTCTCGAGAAATGGTCTTATTGTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008662
VALIDATED
CCBL2 MISSION shRNA Bacterial Glycerol Stock
cysteine conjugate-beta lyase 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-415s1c1
Sequence:CCGGGCAGCAATCGATAGCCTGAATCTCGAGATTCAGGCTATCGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008662.1-1142s1c1
Sequence:CCGGGCATGGATGACCCAGAATGTTCTCGAGAACATTCTGGGTCATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-681s1c1
Sequence:CCGGCCTGAGATCTAAACCTGTTTACTCGAGTAAACAGGTTTAGATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008662.1-861s1c1
Sequence:CCGGCAAATATGACACACTCTGCATCTCGAGATGCAGAGTGTGTCATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001008662.1-847s1c1
Sequence:CCGGGCTGACCTTTGCATCAAATATCTCGAGATATTTGATGCAAAGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001008662.1-407s1c1
Sequence:CCGGCAAAGATTGCAGCAATCGATACTCGAGTATCGATTGCTGCAATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-1772s1c1
Sequence:CCGGGAGATGTTTAACCTCTCAGTACTCGAGTACTGAGAGGTTAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001008662.1-1419s1c1
Sequence:CCGGGTTTGAGAAGTTTGTGCGTTTCTCGAGAAACGCACAAACTTCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008662.1-886s1c1
Sequence:CCGGGATGAGGTTTATGAATGGCTTCTCGAGAAGCCATTCATAAACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-1743s1c1
Sequence:CCGGGTCAGCATAACATAGTGGATACTCGAGTATCCACTATGTTATGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-739s1c1
Sequence:CCGGCCTCAAGAACTGGAAAGTAAACTCGAGTTTACTTTCCAGTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008662.1-475s1c1
Sequence:CCGGGCTCTGTCCTATCTGTATGAACTCGAGTTCATACAGATAGGACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008662
VALIDATED
CCBL2 MISSION shRNA shRNA Plasmid DNA
cysteine conjugate-beta lyase 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-415s1c1
Sequence:CCGGGCAGCAATCGATAGCCTGAATCTCGAGATTCAGGCTATCGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008662.1-1142s1c1
Sequence:CCGGGCATGGATGACCCAGAATGTTCTCGAGAACATTCTGGGTCATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-681s1c1
Sequence:CCGGCCTGAGATCTAAACCTGTTTACTCGAGTAAACAGGTTTAGATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008662.1-861s1c1
Sequence:CCGGCAAATATGACACACTCTGCATCTCGAGATGCAGAGTGTGTCATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001008662.1-847s1c1
Sequence:CCGGGCTGACCTTTGCATCAAATATCTCGAGATATTTGATGCAAAGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001008662.1-407s1c1
Sequence:CCGGCAAAGATTGCAGCAATCGATACTCGAGTATCGATTGCTGCAATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-1772s1c1
Sequence:CCGGGAGATGTTTAACCTCTCAGTACTCGAGTACTGAGAGGTTAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001008662.1-1419s1c1
Sequence:CCGGGTTTGAGAAGTTTGTGCGTTTCTCGAGAAACGCACAAACTTCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008662.1-886s1c1
Sequence:CCGGGATGAGGTTTATGAATGGCTTCTCGAGAAGCCATTCATAAACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-1743s1c1
Sequence:CCGGGTCAGCATAACATAGTGGATACTCGAGTATCCACTATGTTATGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-739s1c1
Sequence:CCGGCCTCAAGAACTGGAAAGTAAACTCGAGTTTACTTTCCAGTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008662.1-475s1c1
Sequence:CCGGGCTCTGTCCTATCTGTATGAACTCGAGTTCATACAGATAGGACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008662
VALIDATED
CCBL2 MISSION shRNA Lentiviral Transduction Particles
cysteine conjugate-beta lyase 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-415s1c1
Sequence:CCGGGCAGCAATCGATAGCCTGAATCTCGAGATTCAGGCTATCGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008662.1-1142s1c1
Sequence:CCGGGCATGGATGACCCAGAATGTTCTCGAGAACATTCTGGGTCATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-681s1c1
Sequence:CCGGCCTGAGATCTAAACCTGTTTACTCGAGTAAACAGGTTTAGATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008662.1-861s1c1
Sequence:CCGGCAAATATGACACACTCTGCATCTCGAGATGCAGAGTGTGTCATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001008662.1-847s1c1
Sequence:CCGGGCTGACCTTTGCATCAAATATCTCGAGATATTTGATGCAAAGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001008662.1-407s1c1
Sequence:CCGGCAAAGATTGCAGCAATCGATACTCGAGTATCGATTGCTGCAATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-1772s1c1
Sequence:CCGGGAGATGTTTAACCTCTCAGTACTCGAGTACTGAGAGGTTAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001008662.1-1419s1c1
Sequence:CCGGGTTTGAGAAGTTTGTGCGTTTCTCGAGAAACGCACAAACTTCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008662.1-886s1c1
Sequence:CCGGGATGAGGTTTATGAATGGCTTCTCGAGAAGCCATTCATAAACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-1743s1c1
Sequence:CCGGGTCAGCATAACATAGTGGATACTCGAGTATCCACTATGTTATGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_001008662.1-739s1c1
Sequence:CCGGCCTCAAGAACTGGAAAGTAAACTCGAGTTTACTTTCCAGTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008662.1-475s1c1
Sequence:CCGGGCTCTGTCCTATCTGTATGAACTCGAGTTCATACAGATAGGACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173763
CCBL2 MISSION shRNA Bacterial Glycerol Stock
cysteine conjugate-beta lyase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173763.2-1297s1c1
Sequence:CCGGGTGAAGTGGATGACGAAACATCTCGAGATGTTTCGTCATCCACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173763.2-1595s1c1
Sequence:CCGGCCTAACCATGTTCGGTACATTCTCGAGAATGTACCGAACATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173763.2-1131s1c1
Sequence:CCGGGCCAAAGGAATTAGAAGTAAACTCGAGTTTACTTCTAATTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173763.2-1276s1c1
Sequence:CCGGGAGCCTTATGACTATAAGTTTCTCGAGAAACTTATAGTCATAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173763.2-463s1c1
Sequence:CCGGCGTCAAATTGATCCAAACGAACTCGAGTTCGTTTGGATCAATTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173763.3-1594s21c1
Sequence:CCGGCCTAACCATGTTCGGTACATTCTCGAGAATGTACCGAACATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173763.3-1130s21c1
Sequence:CCGGGCCAAAGGAATTAGAAGTAAACTCGAGTTTACTTCTAATTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173763.3-1275s21c1
Sequence:CCGGGAGCCTTATGACTATAAGTTTCTCGAGAAACTTATAGTCATAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173763.3-462s21c1
Sequence:CCGGCGTCAAATTGATCCAAACGAACTCGAGTTCGTTTGGATCAATTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173763
CCBL2 MISSION shRNA shRNA Plasmid DNA
cysteine conjugate-beta lyase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173763.2-1297s1c1
Sequence:CCGGGTGAAGTGGATGACGAAACATCTCGAGATGTTTCGTCATCCACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173763.2-1595s1c1
Sequence:CCGGCCTAACCATGTTCGGTACATTCTCGAGAATGTACCGAACATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173763.2-1131s1c1
Sequence:CCGGGCCAAAGGAATTAGAAGTAAACTCGAGTTTACTTCTAATTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173763.2-1276s1c1
Sequence:CCGGGAGCCTTATGACTATAAGTTTCTCGAGAAACTTATAGTCATAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173763.2-463s1c1
Sequence:CCGGCGTCAAATTGATCCAAACGAACTCGAGTTCGTTTGGATCAATTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173763.3-1594s21c1
Sequence:CCGGCCTAACCATGTTCGGTACATTCTCGAGAATGTACCGAACATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173763.3-1130s21c1
Sequence:CCGGGCCAAAGGAATTAGAAGTAAACTCGAGTTTACTTCTAATTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173763.3-1275s21c1
Sequence:CCGGGAGCCTTATGACTATAAGTTTCTCGAGAAACTTATAGTCATAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173763.3-462s21c1
Sequence:CCGGCGTCAAATTGATCCAAACGAACTCGAGTTCGTTTGGATCAATTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173763
CCBL2 MISSION shRNA Lentiviral Transduction Particles
cysteine conjugate-beta lyase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173763.2-1297s1c1
Sequence:CCGGGTGAAGTGGATGACGAAACATCTCGAGATGTTTCGTCATCCACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173763.2-1595s1c1
Sequence:CCGGCCTAACCATGTTCGGTACATTCTCGAGAATGTACCGAACATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173763.2-1131s1c1
Sequence:CCGGGCCAAAGGAATTAGAAGTAAACTCGAGTTTACTTCTAATTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173763.2-1276s1c1
Sequence:CCGGGAGCCTTATGACTATAAGTTTCTCGAGAAACTTATAGTCATAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173763.2-463s1c1
Sequence:CCGGCGTCAAATTGATCCAAACGAACTCGAGTTCGTTTGGATCAATTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173763.3-1594s21c1
Sequence:CCGGCCTAACCATGTTCGGTACATTCTCGAGAATGTACCGAACATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173763.3-1130s21c1
Sequence:CCGGGCCAAAGGAATTAGAAGTAAACTCGAGTTTACTTCTAATTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173763.3-1275s21c1
Sequence:CCGGGAGCCTTATGACTATAAGTTTCTCGAGAAACTTATAGTCATAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173763.3-462s21c1
Sequence:CCGGCGTCAAATTGATCCAAACGAACTCGAGTTCGTTTGGATCAATTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks