EMAIL THIS PAGE TO A FRIEND

CCDC101

coiled-coil domain containing 101

49 Gene Product Result for
Synonyms: SGF29 STAF36
UniProtKB ID: Q96ES7, Q96MF5
Gene ID:
Human(112869) Summary: CCDC101 is a subunit of 2 histone acetyltransferase complexes: the ADA2A (TADA2A; MIM 602276)-containing (ATAC) complex and the SPT3 (SUPT3H; MIM 602947)-TAF9 (MIM 600822)-GCN5 (KAT2A; MIM 602301)/PCAF (KAT2B; MIM 602303) acetylase (STAGA) complex. Both of these complexes contain either GCN5 or PCAF, which are paralogous acetyltransferases (Wang et al., 2008 [PubMed 18838386]
Mouse(75565) coiled-coil domain containing 101
Rat(293488) coiled-coil domain containing 101
Zebrafish(449813) coiled-coil domain containing 101
chicken(424726) coiled-coil domain containing 101
dog(479792) coiled-coil domain containing 101
cow(510859) coiled-coil domain containing 101
domestic cat(101089165) coiled-coil domain containing 101
naked mole-rat(101725712) coiled-coil domain containing 101
domestic guinea pig(100728467) coiled-coil domain containing 101
sheep(101113816) coiled-coil domain containing 101
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029339 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029339 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029339 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138414 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138414 Rosetta Predictions human pricing
NM_001114502 Rosetta Predictions rat pricing
NM_029339 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081007 predicted 467
2 SASI_Hs01_00081008 predicted 731
3 SASI_Hs02_00363554 predicted 417
4 SASI_Hs01_00081009 predicted 413
5 SASI_Hs01_00081010 predicted 335
6 SASI_Hs01_00081011 predicted 266
7 SASI_Hs01_00081012 predicted 748
8 SASI_Hs01_00081013 predicted 198
9 SASI_Hs01_00081014 predicted 467
10 SASI_Hs01_00081016 predicted 394
11 SASI_Hs01_00081015 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252273 predicted 425
2 SASI_Rn02_00252274 predicted 485
3 SASI_Rn02_00252275 predicted 209
4 SASI_Rn02_00252276 predicted 756
5 SASI_Rn02_00252277 predicted 315
6 SASI_Rn02_00252278 predicted 729
7 SASI_Rn02_00252279 predicted 353
8 SASI_Rn02_00252280 predicted 277
9 SASI_Rn02_00252281 predicted 478
10 SASI_Rn02_00252282 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190394 predicted 361
2 SASI_Mm01_00190395 predicted 420
3 SASI_Mm01_00190396 predicted 351
4 SASI_Mm02_00335174 predicted 694
5 SASI_Mm01_00190397 predicted 692
6 SASI_Mm01_00190398 predicted 666
7 SASI_Mm01_00190399 predicted 420
8 SASI_Mm01_00190400 predicted 671
9 SASI_Mm01_00190402 predicted 378
10 SASI_Mm01_00190403 predicted 302
11 SASI_Mm01_00190401 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029339
VALIDATED
CCDC101 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 101
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029339.3-487s21c1
Sequence:CCGGAGATCGCAGGTCTCTACAATGCTCGAGCATTGTAGAGACCTGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029339.3-757s21c1
Sequence:CCGGAGTATGAGGTAGACGACATTGCTCGAGCAATGTCGTCTACCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029339.3-978s21c1
Sequence:CCGGCTGTTTGAAGACACCTCTTATCTCGAGATAAGAGGTGTCTTCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029339.3-431s21c1
Sequence:CCGGGCTGGATAAGATAGCTGAGATCTCGAGATCTCAGCTATCTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029339.3-333s21c1
Sequence:CCGGGAGAACAAGATTTCTCCTTATCTCGAGATAAGGAGAAATCTTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029339.2-369s1c1
Sequence:CCGGGCTGGATAAGATAGCTGAGATCTCGAGATCTCAGCTATCTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029339.2-657s1c1
Sequence:CCGGCCTAGCTGAAGTAGTCAGTTACTCGAGTAACTGACTACTTCAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029339.2-271s1c1
Sequence:CCGGGAGAACAAGATTTCTCCTTATCTCGAGATAAGGAGAAATCTTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029339.2-916s1c1
Sequence:CCGGCTGTTTGAAGACACCTCTTATCTCGAGATAAGAGGTGTCTTCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029339.2-985s1c1
Sequence:CCGGGCTTGTAAGGAGCCCAAGAAACTCGAGTTTCTTGGGCTCCTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029339
VALIDATED
CCDC101 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 101
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029339.3-487s21c1
Sequence:CCGGAGATCGCAGGTCTCTACAATGCTCGAGCATTGTAGAGACCTGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029339.3-757s21c1
Sequence:CCGGAGTATGAGGTAGACGACATTGCTCGAGCAATGTCGTCTACCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029339.3-978s21c1
Sequence:CCGGCTGTTTGAAGACACCTCTTATCTCGAGATAAGAGGTGTCTTCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029339.3-431s21c1
Sequence:CCGGGCTGGATAAGATAGCTGAGATCTCGAGATCTCAGCTATCTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029339.3-333s21c1
Sequence:CCGGGAGAACAAGATTTCTCCTTATCTCGAGATAAGGAGAAATCTTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029339.2-369s1c1
Sequence:CCGGGCTGGATAAGATAGCTGAGATCTCGAGATCTCAGCTATCTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029339.2-657s1c1
Sequence:CCGGCCTAGCTGAAGTAGTCAGTTACTCGAGTAACTGACTACTTCAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029339.2-271s1c1
Sequence:CCGGGAGAACAAGATTTCTCCTTATCTCGAGATAAGGAGAAATCTTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029339.2-916s1c1
Sequence:CCGGCTGTTTGAAGACACCTCTTATCTCGAGATAAGAGGTGTCTTCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029339.2-985s1c1
Sequence:CCGGGCTTGTAAGGAGCCCAAGAAACTCGAGTTTCTTGGGCTCCTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029339
VALIDATED
CCDC101 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 101
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029339.3-487s21c1
Sequence:CCGGAGATCGCAGGTCTCTACAATGCTCGAGCATTGTAGAGACCTGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029339.3-757s21c1
Sequence:CCGGAGTATGAGGTAGACGACATTGCTCGAGCAATGTCGTCTACCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029339.3-978s21c1
Sequence:CCGGCTGTTTGAAGACACCTCTTATCTCGAGATAAGAGGTGTCTTCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029339.3-431s21c1
Sequence:CCGGGCTGGATAAGATAGCTGAGATCTCGAGATCTCAGCTATCTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029339.3-333s21c1
Sequence:CCGGGAGAACAAGATTTCTCCTTATCTCGAGATAAGGAGAAATCTTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029339.2-369s1c1
Sequence:CCGGGCTGGATAAGATAGCTGAGATCTCGAGATCTCAGCTATCTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029339.2-657s1c1
Sequence:CCGGCCTAGCTGAAGTAGTCAGTTACTCGAGTAACTGACTACTTCAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029339.2-271s1c1
Sequence:CCGGGAGAACAAGATTTCTCCTTATCTCGAGATAAGGAGAAATCTTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029339.2-916s1c1
Sequence:CCGGCTGTTTGAAGACACCTCTTATCTCGAGATAAGAGGTGTCTTCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029339.2-985s1c1
Sequence:CCGGGCTTGTAAGGAGCCCAAGAAACTCGAGTTTCTTGGGCTCCTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138414
VALIDATED
CCDC101 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 101
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_138414.1-962s1c1
Sequence:CCGGCCTGTTTGAAGACACCTCCTACTCGAGTAGGAGGTGTCTTCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-318s1c1
Sequence:CCGGGAGAACAAGATTTCTCCCTATCTCGAGATAGGGAGAAATCTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-308s1c1
Sequence:CCGGGATGCAGACAGAGAACAAGATCTCGAGATCTTGTTCTCTGTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-222s1c1
Sequence:CCGGGAGCTCCATCAGCTGATCAAACTCGAGTTTGATCAGCTGATGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_138414.1-1004s1c1
Sequence:CCGGCCTCAATGTGGCTCAGAGATACTCGAGTATCTCTGAGCCACATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138414.1-428s1c1
Sequence:CCGGCGCGGAAATCAAGTCTCTGTTCTCGAGAACAGAGACTTGATTTCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138414.1-732s1c1
Sequence:CCGGGCCACCAACAAGTATGAGGTACTCGAGTACCTCATACTTGTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-963s1c1
Sequence:CCGGCTGTTTGAAGACACCTCCTATCTCGAGATAGGAGGTGTCTTCAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-432s1c1
Sequence:CCGGGAAATCAAGTCTCTGTTGGAACTCGAGTTCCAACAGAGACTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138414.1-269s1c1
Sequence:CCGGCGAACACAACTTAGTGAACATCTCGAGATGTTCACTAAGTTGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-275s1c1
Sequence:CCGGCAACTTAGTGAACATCCAGAACTCGAGTTCTGGATGTTCACTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138414
VALIDATED
CCDC101 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 101
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_138414.1-962s1c1
Sequence:CCGGCCTGTTTGAAGACACCTCCTACTCGAGTAGGAGGTGTCTTCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-318s1c1
Sequence:CCGGGAGAACAAGATTTCTCCCTATCTCGAGATAGGGAGAAATCTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-308s1c1
Sequence:CCGGGATGCAGACAGAGAACAAGATCTCGAGATCTTGTTCTCTGTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-222s1c1
Sequence:CCGGGAGCTCCATCAGCTGATCAAACTCGAGTTTGATCAGCTGATGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_138414.1-1004s1c1
Sequence:CCGGCCTCAATGTGGCTCAGAGATACTCGAGTATCTCTGAGCCACATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138414.1-428s1c1
Sequence:CCGGCGCGGAAATCAAGTCTCTGTTCTCGAGAACAGAGACTTGATTTCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138414.1-732s1c1
Sequence:CCGGGCCACCAACAAGTATGAGGTACTCGAGTACCTCATACTTGTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-963s1c1
Sequence:CCGGCTGTTTGAAGACACCTCCTATCTCGAGATAGGAGGTGTCTTCAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-432s1c1
Sequence:CCGGGAAATCAAGTCTCTGTTGGAACTCGAGTTCCAACAGAGACTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138414.1-269s1c1
Sequence:CCGGCGAACACAACTTAGTGAACATCTCGAGATGTTCACTAAGTTGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-275s1c1
Sequence:CCGGCAACTTAGTGAACATCCAGAACTCGAGTTCTGGATGTTCACTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138414
VALIDATED
CCDC101 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 101
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_138414.1-962s1c1
Sequence:CCGGCCTGTTTGAAGACACCTCCTACTCGAGTAGGAGGTGTCTTCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-318s1c1
Sequence:CCGGGAGAACAAGATTTCTCCCTATCTCGAGATAGGGAGAAATCTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-308s1c1
Sequence:CCGGGATGCAGACAGAGAACAAGATCTCGAGATCTTGTTCTCTGTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-222s1c1
Sequence:CCGGGAGCTCCATCAGCTGATCAAACTCGAGTTTGATCAGCTGATGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_138414.1-1004s1c1
Sequence:CCGGCCTCAATGTGGCTCAGAGATACTCGAGTATCTCTGAGCCACATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138414.1-428s1c1
Sequence:CCGGCGCGGAAATCAAGTCTCTGTTCTCGAGAACAGAGACTTGATTTCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138414.1-732s1c1
Sequence:CCGGGCCACCAACAAGTATGAGGTACTCGAGTACCTCATACTTGTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-963s1c1
Sequence:CCGGCTGTTTGAAGACACCTCCTATCTCGAGATAGGAGGTGTCTTCAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-432s1c1
Sequence:CCGGGAAATCAAGTCTCTGTTGGAACTCGAGTTCCAACAGAGACTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138414.1-269s1c1
Sequence:CCGGCGAACACAACTTAGTGAACATCTCGAGATGTTCACTAAGTTGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138414.1-275s1c1
Sequence:CCGGCAACTTAGTGAACATCCAGAACTCGAGTTCTGGATGTTCACTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks