EMAIL THIS PAGE TO A FRIEND

CCDC102A

coiled-coil domain containing 102A

46 Gene Product Result for
UniProtKB ID: Q96A19, Q9BT74
Gene ID:
Mouse(234582) coiled-coil domain containing 102A
Rat(361363) coiled-coil domain containing 102A
sheep(101120432) coiled-coil domain containing 102A
domestic guinea pig(100722548) coiled-coil domain containing 102A
naked mole-rat(101724749) coiled-coil domain containing 102A
Zebrafish(325319) coiled-coil domain containing 102A
dog(487263) coiled-coil domain containing 102A
chicken(427528) coiled-coil domain containing 102A
cow(513086) coiled-coil domain containing 102A
domestic cat(101091830) coiled-coil domain containing 102A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033533 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033533 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033533 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033212 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033212 Rosetta Predictions human pricing
NM_001108437 Rosetta Predictions rat pricing
NM_001033533 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146116 predicted 1031
2 SASI_Hs01_00146117 predicted 1037
3 SASI_Hs01_00146118 predicted 1634
4 SASI_Hs01_00146119 predicted 1006
5 SASI_Hs01_00146120 predicted 1010
6 SASI_Hs01_00146121 predicted 1695
7 SASI_Hs01_00146122 predicted 1478
8 SASI_Hs01_00146123 predicted 1439
9 SASI_Hs01_00146124 predicted 1321
10 SASI_Hs01_00146125 predicted 1689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238629 predicted 1056
2 SASI_Rn02_00238630 predicted 1974
3 SASI_Rn02_00238631 predicted 982
4 SASI_Rn02_00238632 predicted 1049
5 SASI_Rn02_00238633 predicted 1815
6 SASI_Rn02_00238634 predicted 1730
7 SASI_Rn02_00238635 predicted 547
8 SASI_Rn02_00238636 predicted 1935
9 SASI_Rn02_00238637 predicted 1568
10 SASI_Rn02_00238638 predicted 2023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073802 predicted 2012
2 SASI_Mm01_00073803 predicted 1944
3 SASI_Mm01_00073804 predicted 949
4 SASI_Mm01_00073805 predicted 1011
5 SASI_Mm01_00073806 predicted 1020
6 SASI_Mm01_00073807 predicted 959
7 SASI_Mm01_00073808 predicted 514
8 SASI_Mm01_00073810 predicted 703
9 SASI_Mm01_00073811 predicted 1776
10 SASI_Mm02_00288898 predicted 982
11 SASI_Mm01_00073809 predicted 1398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033533
VALIDATED
CCDC102A MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 102A
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033533.1-1979s1c1
Sequence:CCGGCCTGCTTCAAACCACTTCCTTCTCGAGAAGGAAGTGGTTTGAAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033533.1-1452s1c1
Sequence:CCGGGAGAAGAACAAGGAACTGGCACTCGAGTGCCAGTTCCTTGTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001033533.1-1775s1c1
Sequence:CCGGGAAGATTCGTAGTACCCGATTCTCGAGAATCGGGTACTACGAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033533.1-1502s1c1
Sequence:CCGGGAAGCAGTTTCAAGAGAAGGTCTCGAGACCTTCTCTTGAAACTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033533.1-1130s1c1
Sequence:CCGGCAAACAACTCAGCATCCTAAACTCGAGTTTAGGATGCTGAGTTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033533.1-1074s1c1
Sequence:CCGGCTTAGCCAATGGAAGATCAAACTCGAGTTTGATCTTCCATTGGCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033533.1-989s1c1
Sequence:CCGGGCTAGATGAGTCCCAGAAAGTCTCGAGACTTTCTGGGACTCATCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033533.1-1085s1c1
Sequence:CCGGGAAGATCAAATACGAGGAGTTCTCGAGAACTCCTCGTATTTGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033533.1-2047s21c1
Sequence:CCGGGGAGCCTGTTGGATATGTATACTCGAGTATACATATCCAACAGGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001033533.1-1775s21c1
Sequence:CCGGGAAGATTCGTAGTACCCGATTCTCGAGAATCGGGTACTACGAATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033533.1-1114s21c1
Sequence:CCGGCCAAGCAGGAGATGCTCAAACCTCGAGGTTTGAGCATCTCCTGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033533.1-1075s21c1
Sequence:CCGGTTAGCCAATGGAAGATCAAATCTCGAGATTTGATCTTCCATTGGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001033533.1-988s21c1
Sequence:CCGGGGCTAGATGAGTCCCAGAAAGCTCGAGCTTTCTGGGACTCATCTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033533
VALIDATED
CCDC102A MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 102A
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033533.1-1979s1c1
Sequence:CCGGCCTGCTTCAAACCACTTCCTTCTCGAGAAGGAAGTGGTTTGAAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033533.1-1452s1c1
Sequence:CCGGGAGAAGAACAAGGAACTGGCACTCGAGTGCCAGTTCCTTGTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001033533.1-1775s1c1
Sequence:CCGGGAAGATTCGTAGTACCCGATTCTCGAGAATCGGGTACTACGAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033533.1-1502s1c1
Sequence:CCGGGAAGCAGTTTCAAGAGAAGGTCTCGAGACCTTCTCTTGAAACTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033533.1-1130s1c1
Sequence:CCGGCAAACAACTCAGCATCCTAAACTCGAGTTTAGGATGCTGAGTTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033533.1-1074s1c1
Sequence:CCGGCTTAGCCAATGGAAGATCAAACTCGAGTTTGATCTTCCATTGGCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033533.1-989s1c1
Sequence:CCGGGCTAGATGAGTCCCAGAAAGTCTCGAGACTTTCTGGGACTCATCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033533.1-1085s1c1
Sequence:CCGGGAAGATCAAATACGAGGAGTTCTCGAGAACTCCTCGTATTTGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033533.1-2047s21c1
Sequence:CCGGGGAGCCTGTTGGATATGTATACTCGAGTATACATATCCAACAGGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001033533.1-1775s21c1
Sequence:CCGGGAAGATTCGTAGTACCCGATTCTCGAGAATCGGGTACTACGAATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033533.1-1114s21c1
Sequence:CCGGCCAAGCAGGAGATGCTCAAACCTCGAGGTTTGAGCATCTCCTGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033533.1-1075s21c1
Sequence:CCGGTTAGCCAATGGAAGATCAAATCTCGAGATTTGATCTTCCATTGGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001033533.1-988s21c1
Sequence:CCGGGGCTAGATGAGTCCCAGAAAGCTCGAGCTTTCTGGGACTCATCTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033533
VALIDATED
CCDC102A MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 102A
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033533.1-1979s1c1
Sequence:CCGGCCTGCTTCAAACCACTTCCTTCTCGAGAAGGAAGTGGTTTGAAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033533.1-1452s1c1
Sequence:CCGGGAGAAGAACAAGGAACTGGCACTCGAGTGCCAGTTCCTTGTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001033533.1-1775s1c1
Sequence:CCGGGAAGATTCGTAGTACCCGATTCTCGAGAATCGGGTACTACGAATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033533.1-1502s1c1
Sequence:CCGGGAAGCAGTTTCAAGAGAAGGTCTCGAGACCTTCTCTTGAAACTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033533.1-1130s1c1
Sequence:CCGGCAAACAACTCAGCATCCTAAACTCGAGTTTAGGATGCTGAGTTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033533.1-1074s1c1
Sequence:CCGGCTTAGCCAATGGAAGATCAAACTCGAGTTTGATCTTCCATTGGCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033533.1-989s1c1
Sequence:CCGGGCTAGATGAGTCCCAGAAAGTCTCGAGACTTTCTGGGACTCATCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033533.1-1085s1c1
Sequence:CCGGGAAGATCAAATACGAGGAGTTCTCGAGAACTCCTCGTATTTGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033533.1-2047s21c1
Sequence:CCGGGGAGCCTGTTGGATATGTATACTCGAGTATACATATCCAACAGGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001033533.1-1775s21c1
Sequence:CCGGGAAGATTCGTAGTACCCGATTCTCGAGAATCGGGTACTACGAATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033533.1-1114s21c1
Sequence:CCGGCCAAGCAGGAGATGCTCAAACCTCGAGGTTTGAGCATCTCCTGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033533.1-1075s21c1
Sequence:CCGGTTAGCCAATGGAAGATCAAATCTCGAGATTTGATCTTCCATTGGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001033533.1-988s21c1
Sequence:CCGGGGCTAGATGAGTCCCAGAAAGCTCGAGCTTTCTGGGACTCATCTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033212
CCDC102A MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 102A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033212.2-1038s1c1
Sequence:CCGGGTTGAGCAGGAACATTGAGAACTCGAGTTCTCAATGTTCCTGCTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033212.2-2311s1c1
Sequence:CCGGGCATCTGAAAGTATGGCAGATCTCGAGATCTGCCATACTTTCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033212.2-2036s1c1
Sequence:CCGGGTGGAAAGGAAGCCTATGTTTCTCGAGAAACATAGGCTTCCTTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033212.2-1497s1c1
Sequence:CCGGGAAGAAGCAGTTCCAGGAGAACTCGAGTTCTCCTGGAACTGCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033212.3-1073s21c1
Sequence:CCGGTCAGCCAGTGGAAGATCAAGTCTCGAGACTTGATCTTCCACTGGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033212
CCDC102A MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 102A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033212.2-1038s1c1
Sequence:CCGGGTTGAGCAGGAACATTGAGAACTCGAGTTCTCAATGTTCCTGCTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033212.2-2311s1c1
Sequence:CCGGGCATCTGAAAGTATGGCAGATCTCGAGATCTGCCATACTTTCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033212.2-2036s1c1
Sequence:CCGGGTGGAAAGGAAGCCTATGTTTCTCGAGAAACATAGGCTTCCTTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033212.2-1497s1c1
Sequence:CCGGGAAGAAGCAGTTCCAGGAGAACTCGAGTTCTCCTGGAACTGCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033212.3-1073s21c1
Sequence:CCGGTCAGCCAGTGGAAGATCAAGTCTCGAGACTTGATCTTCCACTGGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033212
CCDC102A MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 102A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033212.2-1038s1c1
Sequence:CCGGGTTGAGCAGGAACATTGAGAACTCGAGTTCTCAATGTTCCTGCTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033212.2-2311s1c1
Sequence:CCGGGCATCTGAAAGTATGGCAGATCTCGAGATCTGCCATACTTTCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033212.2-2036s1c1
Sequence:CCGGGTGGAAAGGAAGCCTATGTTTCTCGAGAAACATAGGCTTCCTTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033212.2-1497s1c1
Sequence:CCGGGAAGAAGCAGTTCCAGGAGAACTCGAGTTCTCCTGGAACTGCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033212.3-1073s21c1
Sequence:CCGGTCAGCCAGTGGAAGATCAAGTCTCGAGACTTGATCTTCCACTGGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)