EMAIL THIS PAGE TO A FRIEND

CCDC102B

coiled-coil domain containing 102B

50 Gene Product Result for
Synonyms: ACY1L AN C18orf14 HsT1731
UniProtKB ID: Q68D86, Q7Z467, Q8NDK7, Q9H5C1
Gene ID:
Horse(100059944) coiled-coil domain containing 102B
domestic cat(101094381) coiled-coil domain containing 102B
dog(483942) coiled-coil domain containing 102B
cow(526711) coiled-coil domain containing 102B
naked mole-rat(101721943) coiled-coil domain containing 102B
domestic guinea pig(100733206) coiled-coil domain containing 102B
sheep(101103523) coiled-coil domain containing 102B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024781 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064571 MISSION® esiRNA esiRNA human CCDC102B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001093729 Rosetta Predictions human pricing
NM_024781 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318123 predicted 694
2 SASI_Hs02_00318124 predicted 1107
3 SASI_Hs02_00318125 predicted 1152
4 SASI_Hs02_00318126 predicted 1732
5 SASI_Hs02_00318127 predicted 1501
6 SASI_Hs02_00318128 predicted 1526
7 SASI_Hs02_00318129 predicted 1190
8 SASI_Hs02_00318130 predicted 729
9 SASI_Hs02_00318131 predicted 1558
10 SASI_Hs02_00318132 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357310 predicted 584
2 SASI_Hs01_00029601 predicted 1003
3 SASI_Hs01_00029602 predicted 1048
4 SASI_Hs01_00029603 predicted 1626
5 SASI_Hs01_00029604 predicted 1396
6 SASI_Hs01_00029605 predicted 1411
7 SASI_Hs01_00029606 predicted 1088
8 SASI_Hs02_00357311 predicted 629
9 SASI_Hs01_00029607 predicted 1455
10 SASI_Hs02_00357312 predicted 305
11 SASI_Hs01_00029598 predicted 215
12 SASI_Hs01_00029599 predicted 552
13 SASI_Hs01_00029600 predicted 716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024781
CCDC102B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 102B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024781.2-1821s21c1
Sequence:CCGGGCCTAACAGATACTGCATATTCTCGAGAATATGCAGTATCTGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024781.2-305s21c1
Sequence:CCGGACACCAACAAATGGGATATTTCTCGAGAAATATCCCATTTGTTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024781.2-159s21c1
Sequence:CCGGGATCTTCCAGATGCAACAATCCTCGAGGATTGTTGCATCTGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024781.2-1991s21c1
Sequence:CCGGTACAAGACGCTGGGTCATTAACTCGAGTTAATGACCCAGCGTCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024781.1-611s1c1
Sequence:CCGGCAAACTCTCAAAGTCCTGATTCTCGAGAATCAGGACTTTGAGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024781.1-708s1c1
Sequence:CCGGCAGACAATACCAGGCAAATATCTCGAGATATTTGCCTGGTATTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024781.1-742s1c1
Sequence:CCGGCATGCAAACAACCGAGTGGATCTCGAGATCCACTCGGTTGTTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024781.1-852s1c1
Sequence:CCGGCCTGAATCAGATCCGTAAGCTCTCGAGAGCTTACGGATCTGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024781.1-1565s1c1
Sequence:CCGGGCTGTAAGCATCGCTGAGAAACTCGAGTTTCTCAGCGATGCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024781.1-139s1c1
Sequence:CCGGGCAATAAATCTGCCTTTGGAACTCGAGTTCCAAAGGCAGATTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024781.1-490s1c1
Sequence:CCGGGAGTGGGACAAGAGGGAAATACTCGAGTATTTCCCTCTTGTCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024781.1-678s1c1
Sequence:CCGGGAACCTTCAACATGCCTACTACTCGAGTAGTAGGCATGTTGAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024781
CCDC102B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 102B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024781.2-1821s21c1
Sequence:CCGGGCCTAACAGATACTGCATATTCTCGAGAATATGCAGTATCTGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024781.2-305s21c1
Sequence:CCGGACACCAACAAATGGGATATTTCTCGAGAAATATCCCATTTGTTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024781.2-159s21c1
Sequence:CCGGGATCTTCCAGATGCAACAATCCTCGAGGATTGTTGCATCTGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024781.2-1991s21c1
Sequence:CCGGTACAAGACGCTGGGTCATTAACTCGAGTTAATGACCCAGCGTCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024781.1-611s1c1
Sequence:CCGGCAAACTCTCAAAGTCCTGATTCTCGAGAATCAGGACTTTGAGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024781.1-708s1c1
Sequence:CCGGCAGACAATACCAGGCAAATATCTCGAGATATTTGCCTGGTATTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024781.1-742s1c1
Sequence:CCGGCATGCAAACAACCGAGTGGATCTCGAGATCCACTCGGTTGTTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024781.1-852s1c1
Sequence:CCGGCCTGAATCAGATCCGTAAGCTCTCGAGAGCTTACGGATCTGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024781.1-1565s1c1
Sequence:CCGGGCTGTAAGCATCGCTGAGAAACTCGAGTTTCTCAGCGATGCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024781.1-139s1c1
Sequence:CCGGGCAATAAATCTGCCTTTGGAACTCGAGTTCCAAAGGCAGATTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024781.1-490s1c1
Sequence:CCGGGAGTGGGACAAGAGGGAAATACTCGAGTATTTCCCTCTTGTCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024781.1-678s1c1
Sequence:CCGGGAACCTTCAACATGCCTACTACTCGAGTAGTAGGCATGTTGAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024781
CCDC102B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 102B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024781.2-1821s21c1
Sequence:CCGGGCCTAACAGATACTGCATATTCTCGAGAATATGCAGTATCTGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024781.2-305s21c1
Sequence:CCGGACACCAACAAATGGGATATTTCTCGAGAAATATCCCATTTGTTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024781.2-159s21c1
Sequence:CCGGGATCTTCCAGATGCAACAATCCTCGAGGATTGTTGCATCTGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024781.2-1991s21c1
Sequence:CCGGTACAAGACGCTGGGTCATTAACTCGAGTTAATGACCCAGCGTCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024781.1-611s1c1
Sequence:CCGGCAAACTCTCAAAGTCCTGATTCTCGAGAATCAGGACTTTGAGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024781.1-708s1c1
Sequence:CCGGCAGACAATACCAGGCAAATATCTCGAGATATTTGCCTGGTATTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024781.1-742s1c1
Sequence:CCGGCATGCAAACAACCGAGTGGATCTCGAGATCCACTCGGTTGTTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024781.1-852s1c1
Sequence:CCGGCCTGAATCAGATCCGTAAGCTCTCGAGAGCTTACGGATCTGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024781.1-1565s1c1
Sequence:CCGGGCTGTAAGCATCGCTGAGAAACTCGAGTTTCTCAGCGATGCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024781.1-139s1c1
Sequence:CCGGGCAATAAATCTGCCTTTGGAACTCGAGTTCCAAAGGCAGATTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024781.1-490s1c1
Sequence:CCGGGAGTGGGACAAGAGGGAAATACTCGAGTATTTCCCTCTTGTCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024781.1-678s1c1
Sequence:CCGGGAACCTTCAACATGCCTACTACTCGAGTAGTAGGCATGTTGAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks