EMAIL THIS PAGE TO A FRIEND

CCDC103

coiled-coil domain containing 103

58 Gene Product Result for
Synonyms: CILD17 PR46b SMH
UniProtKB ID: Q8IW40, A8K145, B8ZZU0
Gene ID:
Human(388389) Summary: This gene encodes a protein that contains a coiled-coil domain. [provided by RefSeq, Apr 2012]
Mouse(73293) coiled-coil domain containing 103
Rat(498006) coiled-coil domain containing 103
sheep(101117001) coiled-coil domain containing 103
domestic guinea pig(100725992) coiled-coil domain containing 103
naked mole-rat(101708718) coiled-coil domain containing 103
Zebrafish(437026) coiled-coil domain containing 103
domestic cat(101081684) coiled-coil domain containing 103
dog(490934) coiled-coil domain containing 103
cow(509424) coiled-coil domain containing 103
chicken(419970) coiled-coil domain containing 103
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_213607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_213607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_213607 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115181 MISSION® esiRNA esiRNA human CCDC103 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213607 Rosetta Predictions human pricing
NM_001109049 Rosetta Predictions rat pricing
XM_573202 Rosetta Predictions rat pricing
NM_028492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049394 predicted 601
2 SASI_Hs01_00049395 predicted 292
3 SASI_Hs01_00049396 predicted 909
4 SASI_Hs01_00049397 predicted 387
5 SASI_Hs01_00049398 predicted 431
6 SASI_Hs01_00049399 predicted 1001
7 SASI_Hs01_00049400 predicted 1012
8 SASI_Hs01_00049402 predicted 320
9 SASI_Hs01_00049403 predicted 906
10 SASI_Hs02_00374291 predicted 393
11 SASI_Hs01_00049401 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244620 predicted 402
2 SASI_Rn02_00244621 predicted 326
3 SASI_Rn02_00244622 predicted 497
4 SASI_Rn02_00244623 predicted 666
5 SASI_Rn02_00244624 predicted 501
6 SASI_Rn02_00244625 predicted 386
7 SASI_Rn02_00244626 predicted 278
8 SASI_Rn02_00244627 predicted 532
9 SASI_Rn02_00244628 predicted 391
10 SASI_Rn02_00244629 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168422 predicted 661
2 SASI_Rn01_00168423 predicted 626
3 SASI_Rn01_00168424 predicted 669
4 SASI_Rn01_00168425 predicted 604
5 SASI_Rn01_00168426 predicted 647
6 SASI_Rn01_00168427 predicted 632
7 SASI_Rn01_00168428 predicted 599
8 SASI_Rn01_00168429 predicted 218
9 SASI_Rn01_00168430 predicted 141
10 SASI_Rn01_00168431 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169646 predicted 1255
2 SASI_Mm01_00169647 predicted 1151
3 SASI_Mm01_00169648 predicted 869
4 SASI_Mm02_00333959 predicted 377
5 SASI_Mm01_00169649 predicted 668
6 SASI_Mm01_00169650 predicted 297
7 SASI_Mm01_00169651 predicted 1136
8 SASI_Mm01_00169652 predicted 1363
9 SASI_Mm01_00169653 predicted 479
10 SASI_Mm01_00169654 predicted 848
11 SASI_Mm01_00169645 predicted 1195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213607
CCDC103 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 103
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213607.1-153s1c1
Sequence:CCGGGAGAAGTACAAACGGGAGAATCTCGAGATTCTCCCGTTTGTACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213607.1-665s1c1
Sequence:CCGGGTTTCAGAAGCTGCAAGCCATCTCGAGATGGCTTGCAGCTTCTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213607.1-878s21c1
Sequence:CCGGGGTTCTGCAGGACCATAATAACTCGAGTTATTATGGTCCTGCAGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213607.1-145s21c1
Sequence:CCGGCTGCTGATGAGAAGTACAAACCTCGAGGTTTGTACTTCTCATCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213607.1-389s21c1
Sequence:CCGGTGCTGACTTCTATCGTGATTGCTCGAGCAATCACGATAGAAGTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213607.1-298s21c1
Sequence:CCGGCCTGGAACTGTCACACTATTCCTCGAGGAATAGTGTGACAGTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213607.1-333s21c1
Sequence:CCGGCAGGATGTGGCCACTGAAATCCTCGAGGATTTCAGTGGCCACATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213607
CCDC103 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 103
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213607.1-153s1c1
Sequence:CCGGGAGAAGTACAAACGGGAGAATCTCGAGATTCTCCCGTTTGTACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213607.1-665s1c1
Sequence:CCGGGTTTCAGAAGCTGCAAGCCATCTCGAGATGGCTTGCAGCTTCTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213607.1-878s21c1
Sequence:CCGGGGTTCTGCAGGACCATAATAACTCGAGTTATTATGGTCCTGCAGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213607.1-145s21c1
Sequence:CCGGCTGCTGATGAGAAGTACAAACCTCGAGGTTTGTACTTCTCATCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213607.1-389s21c1
Sequence:CCGGTGCTGACTTCTATCGTGATTGCTCGAGCAATCACGATAGAAGTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213607.1-298s21c1
Sequence:CCGGCCTGGAACTGTCACACTATTCCTCGAGGAATAGTGTGACAGTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213607.1-333s21c1
Sequence:CCGGCAGGATGTGGCCACTGAAATCCTCGAGGATTTCAGTGGCCACATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213607
CCDC103 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 103
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213607.1-153s1c1
Sequence:CCGGGAGAAGTACAAACGGGAGAATCTCGAGATTCTCCCGTTTGTACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213607.1-665s1c1
Sequence:CCGGGTTTCAGAAGCTGCAAGCCATCTCGAGATGGCTTGCAGCTTCTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213607.1-878s21c1
Sequence:CCGGGGTTCTGCAGGACCATAATAACTCGAGTTATTATGGTCCTGCAGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213607.1-145s21c1
Sequence:CCGGCTGCTGATGAGAAGTACAAACCTCGAGGTTTGTACTTCTCATCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213607.1-389s21c1
Sequence:CCGGTGCTGACTTCTATCGTGATTGCTCGAGCAATCACGATAGAAGTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213607.1-298s21c1
Sequence:CCGGCCTGGAACTGTCACACTATTCCTCGAGGAATAGTGTGACAGTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213607.1-333s21c1
Sequence:CCGGCAGGATGTGGCCACTGAAATCCTCGAGGATTTCAGTGGCCACATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028492
CCDC103 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 103
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028492.1-847s1c1
Sequence:CCGGGAGCTGCTAGAACTGTATGGACTCGAGTCCATACAGTTCTAGCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028492.1-410s1c1
Sequence:CCGGCTCAAGATGTGGTCACTGAAACTCGAGTTTCAGTGACCACATCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028492.1-223s1c1
Sequence:CCGGGCTGCTGACGAGAAGTACAAACTCGAGTTTGTACTTCTCGTCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028492.1-291s1c1
Sequence:CCGGCTATGAGGAGTTCAGAGGTATCTCGAGATACCTCTGAACTCCTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028492.1-1429s1c1
Sequence:CCGGCCTTCATCTGAGATGCACAATCTCGAGATTGTGCATCTCAGATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028492.1-354s1c1
Sequence:CCGGGATGGGAGGAAAGAGATTTGTCTCGAGACAAATCTCTTTCCTCCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028492
CCDC103 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 103
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028492.1-847s1c1
Sequence:CCGGGAGCTGCTAGAACTGTATGGACTCGAGTCCATACAGTTCTAGCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028492.1-410s1c1
Sequence:CCGGCTCAAGATGTGGTCACTGAAACTCGAGTTTCAGTGACCACATCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028492.1-223s1c1
Sequence:CCGGGCTGCTGACGAGAAGTACAAACTCGAGTTTGTACTTCTCGTCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028492.1-291s1c1
Sequence:CCGGCTATGAGGAGTTCAGAGGTATCTCGAGATACCTCTGAACTCCTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028492.1-1429s1c1
Sequence:CCGGCCTTCATCTGAGATGCACAATCTCGAGATTGTGCATCTCAGATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028492.1-354s1c1
Sequence:CCGGGATGGGAGGAAAGAGATTTGTCTCGAGACAAATCTCTTTCCTCCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028492
CCDC103 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 103
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028492.1-847s1c1
Sequence:CCGGGAGCTGCTAGAACTGTATGGACTCGAGTCCATACAGTTCTAGCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028492.1-410s1c1
Sequence:CCGGCTCAAGATGTGGTCACTGAAACTCGAGTTTCAGTGACCACATCTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028492.1-223s1c1
Sequence:CCGGGCTGCTGACGAGAAGTACAAACTCGAGTTTGTACTTCTCGTCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028492.1-291s1c1
Sequence:CCGGCTATGAGGAGTTCAGAGGTATCTCGAGATACCTCTGAACTCCTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028492.1-1429s1c1
Sequence:CCGGCCTTCATCTGAGATGCACAATCTCGAGATTGTGCATCTCAGATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028492.1-354s1c1
Sequence:CCGGGATGGGAGGAAAGAGATTTGTCTCGAGACAAATCTCTTTCCTCCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)