EMAIL THIS PAGE TO A FRIEND

CCDC104

coiled-coil domain containing 104

UniProtKB ID: Q96G28, Q53SF0, Q53ST9, Q6UY34
Gene ID:
Mouse(216618) coiled-coil domain containing 104
Rat(289859) coiled-coil domain containing 104
Zebrafish(678564) coiled-coil domain containing 104
chicken(421209) coiled-coil domain containing 104
cow(513777) coiled-coil domain containing 104
domestic cat(101093679) coiled-coil domain containing 104
dog(474602) coiled-coil domain containing 104
naked mole-rat(101706239) coiled-coil domain containing 104
domestic guinea pig(100721875) coiled-coil domain containing 104
sheep(101121587) coiled-coil domain containing 104
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080667 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080667 Rosetta Predictions human pricing
NM_001024866 Rosetta Predictions rat pricing
NM_025740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084420 predicted 327
2 SASI_Hs01_00084421 predicted 938
3 SASI_Hs02_00362429 predicted 380
4 SASI_Hs01_00084422 predicted 1050
5 SASI_Hs01_00084424 predicted 330
6 SASI_Hs01_00084425 predicted 1060
7 SASI_Hs02_00362430 predicted 887
8 SASI_Hs02_00362431 predicted 971
9 SASI_Hs01_00084427 predicted 953
10 SASI_Hs01_00084428 predicted 466
11 SASI_Hs01_00084419 predicted 492
12 SASI_Hs01_00084423 predicted 423
13 SASI_Hs01_00084426 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069452 predicted 260
2 SASI_Rn01_00069453 predicted 1078
3 SASI_Rn01_00069454 predicted 513
4 SASI_Rn01_00069456 predicted 751
5 SASI_Rn01_00069457 predicted 779
6 SASI_Rn01_00069458 predicted 1198
7 SASI_Rn01_00069459 predicted 874
8 SASI_Rn01_00069461 predicted 1098
9 SASI_Rn02_00202743 predicted 953
10 SASI_Rn02_00202744 predicted 324
11 SASI_Rn01_00069455 predicted 1127
12 SASI_Rn01_00069460 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154387 predicted 518
2 SASI_Mm01_00154388 predicted 323
3 SASI_Mm01_00154389 predicted 838
4 SASI_Mm01_00154390 predicted 338
5 SASI_Mm01_00154391 predicted 548
6 SASI_Mm01_00154392 predicted 540
7 SASI_Mm01_00154394 predicted 809
8 SASI_Mm01_00154395 predicted 940
9 SASI_Mm01_00154396 predicted 896
10 SASI_Mm02_00328922 predicted 761
11 SASI_Mm01_00154393 predicted 1162
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080667
VALIDATED
CCDC104 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 104
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080667.5-1008s21c1
Sequence:CCGGGCAACGAGAACACTATCTCAACTCGAGTTGAGATAGTGTTCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080667.5-1056s21c1
Sequence:CCGGGAGAAAGGATATGAGGACTAACTCGAGTTAGTCCTCATATCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080667.5-643s21c1
Sequence:CCGGCTTGAACACGAAGAGATGAAACTCGAGTTTCATCTCTTCGTGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080667.5-952s21c1
Sequence:CCGGGCGAGCATTGAAGGACCAATACTCGAGTATTGGTCCTTCAATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080667.3-704s1c1
Sequence:CCGGGATGTGGTCAGTGACCTTGAACTCGAGTTCAAGGTCACTGACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_080667.3-1028s1c1
Sequence:CCGGGCGAGCATTGAAGGACCAATACTCGAGTATTGGTCCTTCAATGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080667.3-719s1c1
Sequence:CCGGCTTGAACACGAAGAGATGAAACTCGAGTTTCATCTCTTCGTGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_080667.3-1132s1c1
Sequence:CCGGGAGAAAGGATATGAGGACTAACTCGAGTTAGTCCTCATATCCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080667.3-1102s1c1
Sequence:CCGGCAAGCAGAAGAGAGATAAGTTCTCGAGAACTTATCTCTCTTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080667.3-1213s1c1
Sequence:CCGGGAAACCAGAAATGACAGCAGACTCGAGTCTGCTGTCATTTCTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080667.3-1084s1c1
Sequence:CCGGGCAACGAGAACACTATCTCAACTCGAGTTGAGATAGTGTTCTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080667
VALIDATED
CCDC104 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 104
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080667.5-1008s21c1
Sequence:CCGGGCAACGAGAACACTATCTCAACTCGAGTTGAGATAGTGTTCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080667.5-1056s21c1
Sequence:CCGGGAGAAAGGATATGAGGACTAACTCGAGTTAGTCCTCATATCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080667.5-643s21c1
Sequence:CCGGCTTGAACACGAAGAGATGAAACTCGAGTTTCATCTCTTCGTGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080667.5-952s21c1
Sequence:CCGGGCGAGCATTGAAGGACCAATACTCGAGTATTGGTCCTTCAATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080667.3-704s1c1
Sequence:CCGGGATGTGGTCAGTGACCTTGAACTCGAGTTCAAGGTCACTGACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_080667.3-1028s1c1
Sequence:CCGGGCGAGCATTGAAGGACCAATACTCGAGTATTGGTCCTTCAATGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080667.3-719s1c1
Sequence:CCGGCTTGAACACGAAGAGATGAAACTCGAGTTTCATCTCTTCGTGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_080667.3-1132s1c1
Sequence:CCGGGAGAAAGGATATGAGGACTAACTCGAGTTAGTCCTCATATCCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080667.3-1102s1c1
Sequence:CCGGCAAGCAGAAGAGAGATAAGTTCTCGAGAACTTATCTCTCTTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080667.3-1213s1c1
Sequence:CCGGGAAACCAGAAATGACAGCAGACTCGAGTCTGCTGTCATTTCTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080667.3-1084s1c1
Sequence:CCGGGCAACGAGAACACTATCTCAACTCGAGTTGAGATAGTGTTCTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080667
VALIDATED
CCDC104 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 104
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080667.5-1008s21c1
Sequence:CCGGGCAACGAGAACACTATCTCAACTCGAGTTGAGATAGTGTTCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080667.5-1056s21c1
Sequence:CCGGGAGAAAGGATATGAGGACTAACTCGAGTTAGTCCTCATATCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080667.5-643s21c1
Sequence:CCGGCTTGAACACGAAGAGATGAAACTCGAGTTTCATCTCTTCGTGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080667.5-952s21c1
Sequence:CCGGGCGAGCATTGAAGGACCAATACTCGAGTATTGGTCCTTCAATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080667.3-704s1c1
Sequence:CCGGGATGTGGTCAGTGACCTTGAACTCGAGTTCAAGGTCACTGACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_080667.3-1028s1c1
Sequence:CCGGGCGAGCATTGAAGGACCAATACTCGAGTATTGGTCCTTCAATGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080667.3-719s1c1
Sequence:CCGGCTTGAACACGAAGAGATGAAACTCGAGTTTCATCTCTTCGTGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_080667.3-1132s1c1
Sequence:CCGGGAGAAAGGATATGAGGACTAACTCGAGTTAGTCCTCATATCCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080667.3-1102s1c1
Sequence:CCGGCAAGCAGAAGAGAGATAAGTTCTCGAGAACTTATCTCTCTTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080667.3-1213s1c1
Sequence:CCGGGAAACCAGAAATGACAGCAGACTCGAGTCTGCTGTCATTTCTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080667.3-1084s1c1
Sequence:CCGGGCAACGAGAACACTATCTCAACTCGAGTTGAGATAGTGTTCTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025740
VALIDATED
CCDC104 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 104
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025740.3-519s21c1
Sequence:CCGGCGAATAATCCAGGAGAGGAATCTCGAGATTCCTCTCCTGGATTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025740.3-1279s21c1
Sequence:CCGGGCAACTGTGAACTGACTATTACTCGAGTAATAGTCAGTTCACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025740.3-332s21c1
Sequence:CCGGGCTGTTAGAAAGTTACCTCAACTCGAGTTGAGGTAACTTTCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025740.3-1131s21c1
Sequence:CCGGCGATTGCTTGCAGAGAAACTTCTCGAGAAGTTTCTCTGCAAGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025740.1-520s1c1
Sequence:CCGGCGAATAATCCAGGAGAGGAATCTCGAGATTCCTCTCCTGGATTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025740.1-1280s1c1
Sequence:CCGGGCAACTGTGAACTGACTATTACTCGAGTAATAGTCAGTTCACAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025740.1-333s1c1
Sequence:CCGGGCTGTTAGAAAGTTACCTCAACTCGAGTTGAGGTAACTTTCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025740.1-1132s1c1
Sequence:CCGGCGATTGCTTGCAGAGAAACTTCTCGAGAAGTTTCTCTGCAAGCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025740.1-901s1c1
Sequence:CCGGGCAAGCATGGAAGGACCAATACTCGAGTATTGGTCCTTCCATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025740.1-1342s1c1
Sequence:CCGGCGTCTGCAGAAATCCAGGTATCTCGAGATACCTGGATTTCTGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025740.1-779s1c1
Sequence:CCGGCCTCAGAAGTTAAAGTGCATTCTCGAGAATGCACTTTAACTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025740.1-1317s1c1
Sequence:CCGGGCAAGAGGGAAGGCAATTTAACTCGAGTTAAATTGCCTTCCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025740.1-1005s1c1
Sequence:CCGGGAGAAAGGATACGAGGACAAACTCGAGTTTGTCCTCGTATCCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025740
VALIDATED
CCDC104 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 104
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025740.3-519s21c1
Sequence:CCGGCGAATAATCCAGGAGAGGAATCTCGAGATTCCTCTCCTGGATTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025740.3-1279s21c1
Sequence:CCGGGCAACTGTGAACTGACTATTACTCGAGTAATAGTCAGTTCACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025740.3-332s21c1
Sequence:CCGGGCTGTTAGAAAGTTACCTCAACTCGAGTTGAGGTAACTTTCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025740.3-1131s21c1
Sequence:CCGGCGATTGCTTGCAGAGAAACTTCTCGAGAAGTTTCTCTGCAAGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025740.1-520s1c1
Sequence:CCGGCGAATAATCCAGGAGAGGAATCTCGAGATTCCTCTCCTGGATTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025740.1-1280s1c1
Sequence:CCGGGCAACTGTGAACTGACTATTACTCGAGTAATAGTCAGTTCACAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025740.1-333s1c1
Sequence:CCGGGCTGTTAGAAAGTTACCTCAACTCGAGTTGAGGTAACTTTCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025740.1-1132s1c1
Sequence:CCGGCGATTGCTTGCAGAGAAACTTCTCGAGAAGTTTCTCTGCAAGCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025740.1-901s1c1
Sequence:CCGGGCAAGCATGGAAGGACCAATACTCGAGTATTGGTCCTTCCATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025740.1-1342s1c1
Sequence:CCGGCGTCTGCAGAAATCCAGGTATCTCGAGATACCTGGATTTCTGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025740.1-779s1c1
Sequence:CCGGCCTCAGAAGTTAAAGTGCATTCTCGAGAATGCACTTTAACTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025740.1-1317s1c1
Sequence:CCGGGCAAGAGGGAAGGCAATTTAACTCGAGTTAAATTGCCTTCCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025740.1-1005s1c1
Sequence:CCGGGAGAAAGGATACGAGGACAAACTCGAGTTTGTCCTCGTATCCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025740
VALIDATED
CCDC104 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 104
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025740.3-519s21c1
Sequence:CCGGCGAATAATCCAGGAGAGGAATCTCGAGATTCCTCTCCTGGATTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025740.3-1279s21c1
Sequence:CCGGGCAACTGTGAACTGACTATTACTCGAGTAATAGTCAGTTCACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025740.3-332s21c1
Sequence:CCGGGCTGTTAGAAAGTTACCTCAACTCGAGTTGAGGTAACTTTCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025740.3-1131s21c1
Sequence:CCGGCGATTGCTTGCAGAGAAACTTCTCGAGAAGTTTCTCTGCAAGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025740.1-520s1c1
Sequence:CCGGCGAATAATCCAGGAGAGGAATCTCGAGATTCCTCTCCTGGATTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025740.1-1280s1c1
Sequence:CCGGGCAACTGTGAACTGACTATTACTCGAGTAATAGTCAGTTCACAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025740.1-333s1c1
Sequence:CCGGGCTGTTAGAAAGTTACCTCAACTCGAGTTGAGGTAACTTTCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025740.1-1132s1c1
Sequence:CCGGCGATTGCTTGCAGAGAAACTTCTCGAGAAGTTTCTCTGCAAGCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025740.1-901s1c1
Sequence:CCGGGCAAGCATGGAAGGACCAATACTCGAGTATTGGTCCTTCCATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025740.1-1342s1c1
Sequence:CCGGCGTCTGCAGAAATCCAGGTATCTCGAGATACCTGGATTTCTGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025740.1-779s1c1
Sequence:CCGGCCTCAGAAGTTAAAGTGCATTCTCGAGAATGCACTTTAACTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025740.1-1317s1c1
Sequence:CCGGGCAAGAGGGAAGGCAATTTAACTCGAGTTAAATTGCCTTCCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025740.1-1005s1c1
Sequence:CCGGGAGAAAGGATACGAGGACAAACTCGAGTTTGTCCTCGTATCCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks