EMAIL THIS PAGE TO A FRIEND

CCDC105

coiled-coil domain containing 105

58 Gene Product Result for
UniProtKB ID: Q8IYK2, Q8N7T5, Q8NDL5
Gene ID:
Mouse(70976) coiled-coil domain containing 105
Rat(500800) coiled-coil domain containing 105
sheep(101103234) coiled-coil domain containing 105
domestic guinea pig(100730130) coiled-coil domain containing 105
naked mole-rat(101719745) coiled-coil domain containing 105
dog(610464) coiled-coil domain containing 105
cow(528661) coiled-coil domain containing 105
domestic cat(101087715) coiled-coil domain containing 105
dog(610469) coiled-coil domain containing 105
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173482 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145191 MISSION® esiRNA esiRNA human CCDC105 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173482 Rosetta Predictions human pricing
NM_001025774 Rosetta Predictions rat pricing
XM_147407 Rosetta Predictions mouse pricing
XM_909809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223753 predicted 980
2 SASI_Hs01_00223754 predicted 775
3 SASI_Hs01_00223755 predicted 1278
4 SASI_Hs01_00223756 predicted 985
5 SASI_Hs01_00223757 predicted 1170
6 SASI_Hs01_00223758 predicted 1168
7 SASI_Hs01_00223759 predicted 1415
8 SASI_Hs01_00223760 predicted 1000
9 SASI_Hs01_00223761 predicted 1213
10 SASI_Hs01_00223762 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054541 predicted 1187
2 SASI_Rn01_00054542 predicted 940
3 SASI_Rn01_00054543 predicted 1064
4 SASI_Rn01_00054544 predicted 753
5 SASI_Rn01_00054545 predicted 792
6 SASI_Rn01_00054546 predicted 1037
7 SASI_Rn01_00054547 predicted 1110
8 SASI_Rn01_00054548 predicted 1142
9 SASI_Rn01_00054549 predicted 762
10 SASI_Rn01_00054550 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_147407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279983 predicted 653
2 SASI_Mm01_00279984 predicted 671
3 SASI_Mm01_00279985 predicted 814
4 SASI_Mm01_00279986 predicted 359
5 SASI_Mm01_00279987 predicted 678
6 SASI_Mm01_00279988 predicted 817
7 SASI_Mm01_00279989 predicted 835
8 SASI_Mm01_00279990 predicted 792
9 SASI_Mm01_00279991 predicted 910
10 SASI_Mm01_00279992 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435113 predicted 1363
2 SASI_Mm02_00435114 predicted 967
3 SASI_Mm02_00435115 predicted 1445
4 SASI_Mm02_00435116 predicted 1105
5 SASI_Mm02_00435117 predicted 1389
6 SASI_Mm02_00435118 predicted 821
7 SASI_Mm02_00435119 predicted 1169
8 SASI_Mm02_00435120 predicted 830
9 SASI_Mm02_00435121 predicted 794
10 SASI_Mm02_00435122 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173482
CCDC105 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 105
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-670s1c1
Sequence:CCGGCAGTATGCTTACATGGGAGAACTCGAGTTCTCCCATGTAAGCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-1011s1c1
Sequence:CCGGCCTTGGTAGAAATGGCAAAGACTCGAGTCTTTGCCATTTCTACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-586s1c1
Sequence:CCGGGCGCAAGGGTCTGCTTATTAACTCGAGTTAATAAGCAGACCCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-1111s1c1
Sequence:CCGGCTTGGAGCTGAAGGAAAGATTCTCGAGAATCTTTCCTTCAGCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-659s1c1
Sequence:CCGGGACAAAGCTGACAGTATGCTTCTCGAGAAGCATACTGTCAGCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-594s1c1
Sequence:CCGGGTCTGCTTATTAACCAGCAGACTCGAGTCTGCTGGTTAATAAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-1003s1c1
Sequence:CCGGCAAGGACACCTTGGTAGAAATCTCGAGATTTCTACCAAGGTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-1002s1c1
Sequence:CCGGCCAAGGACACCTTGGTAGAAACTCGAGTTTCTACCAAGGTGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173482.2-948s21c1
Sequence:CCGGAGACCCTGTGGGCACCTATAACTCGAGTTATAGGTGCCCACAGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173482.2-989s21c1
Sequence:CCGGTAAACGAAGCCAAGCGGTTGTCTCGAGACAACCGCTTGGCTTCGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173482.2-1151s21c1
Sequence:CCGGATATGACGTTAGGACTGATGACTCGAGTCATCAGTCCTAACGTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173482
CCDC105 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 105
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-670s1c1
Sequence:CCGGCAGTATGCTTACATGGGAGAACTCGAGTTCTCCCATGTAAGCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-1011s1c1
Sequence:CCGGCCTTGGTAGAAATGGCAAAGACTCGAGTCTTTGCCATTTCTACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-586s1c1
Sequence:CCGGGCGCAAGGGTCTGCTTATTAACTCGAGTTAATAAGCAGACCCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-1111s1c1
Sequence:CCGGCTTGGAGCTGAAGGAAAGATTCTCGAGAATCTTTCCTTCAGCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-659s1c1
Sequence:CCGGGACAAAGCTGACAGTATGCTTCTCGAGAAGCATACTGTCAGCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-594s1c1
Sequence:CCGGGTCTGCTTATTAACCAGCAGACTCGAGTCTGCTGGTTAATAAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-1003s1c1
Sequence:CCGGCAAGGACACCTTGGTAGAAATCTCGAGATTTCTACCAAGGTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-1002s1c1
Sequence:CCGGCCAAGGACACCTTGGTAGAAACTCGAGTTTCTACCAAGGTGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173482.2-948s21c1
Sequence:CCGGAGACCCTGTGGGCACCTATAACTCGAGTTATAGGTGCCCACAGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173482.2-989s21c1
Sequence:CCGGTAAACGAAGCCAAGCGGTTGTCTCGAGACAACCGCTTGGCTTCGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173482.2-1151s21c1
Sequence:CCGGATATGACGTTAGGACTGATGACTCGAGTCATCAGTCCTAACGTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173482
CCDC105 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 105
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-670s1c1
Sequence:CCGGCAGTATGCTTACATGGGAGAACTCGAGTTCTCCCATGTAAGCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-1011s1c1
Sequence:CCGGCCTTGGTAGAAATGGCAAAGACTCGAGTCTTTGCCATTTCTACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-586s1c1
Sequence:CCGGGCGCAAGGGTCTGCTTATTAACTCGAGTTAATAAGCAGACCCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-1111s1c1
Sequence:CCGGCTTGGAGCTGAAGGAAAGATTCTCGAGAATCTTTCCTTCAGCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-659s1c1
Sequence:CCGGGACAAAGCTGACAGTATGCTTCTCGAGAAGCATACTGTCAGCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-594s1c1
Sequence:CCGGGTCTGCTTATTAACCAGCAGACTCGAGTCTGCTGGTTAATAAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-1003s1c1
Sequence:CCGGCAAGGACACCTTGGTAGAAATCTCGAGATTTCTACCAAGGTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173482.1-1002s1c1
Sequence:CCGGCCAAGGACACCTTGGTAGAAACTCGAGTTTCTACCAAGGTGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173482.2-948s21c1
Sequence:CCGGAGACCCTGTGGGCACCTATAACTCGAGTTATAGGTGCCCACAGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173482.2-989s21c1
Sequence:CCGGTAAACGAAGCCAAGCGGTTGTCTCGAGACAACCGCTTGGCTTCGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173482.2-1151s21c1
Sequence:CCGGATATGACGTTAGGACTGATGACTCGAGTCATCAGTCCTAACGTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027630
CCDC105 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 105
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-1277s21c1
Sequence:CCGGGACCCTTGGTTCGCATGTATCCTCGAGGATACATGCGAACCAAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-1172s21c1
Sequence:CCGGCTATCCACCGGTGCATGAAATCTCGAGATTTCATGCACCGGTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-1399s21c1
Sequence:CCGGCTCCGTACAACACACGATAACCTCGAGGTTATCGTGTGTTGTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-1007s21c1
Sequence:CCGGTGGAGTCCAAAGACATCTTAACTCGAGTTAAGATGTCTTTGGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-311s21c1
Sequence:CCGGTTCGGGTAGAGATGCTCAAAGCTCGAGCTTTGAGCATCTCTACCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027630
CCDC105 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 105
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-1277s21c1
Sequence:CCGGGACCCTTGGTTCGCATGTATCCTCGAGGATACATGCGAACCAAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-1172s21c1
Sequence:CCGGCTATCCACCGGTGCATGAAATCTCGAGATTTCATGCACCGGTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-1399s21c1
Sequence:CCGGCTCCGTACAACACACGATAACCTCGAGGTTATCGTGTGTTGTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-1007s21c1
Sequence:CCGGTGGAGTCCAAAGACATCTTAACTCGAGTTAAGATGTCTTTGGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-311s21c1
Sequence:CCGGTTCGGGTAGAGATGCTCAAAGCTCGAGCTTTGAGCATCTCTACCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027630
CCDC105 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 105
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-1277s21c1
Sequence:CCGGGACCCTTGGTTCGCATGTATCCTCGAGGATACATGCGAACCAAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-1172s21c1
Sequence:CCGGCTATCCACCGGTGCATGAAATCTCGAGATTTCATGCACCGGTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-1399s21c1
Sequence:CCGGCTCCGTACAACACACGATAACCTCGAGGTTATCGTGTGTTGTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-1007s21c1
Sequence:CCGGTGGAGTCCAAAGACATCTTAACTCGAGTTAAGATGTCTTTGGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027630.1-311s21c1
Sequence:CCGGTTCGGGTAGAGATGCTCAAAGCTCGAGCTTTGAGCATCTCTACCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks