EMAIL THIS PAGE TO A FRIEND

CCDC106

coiled-coil domain containing 106

61 Gene Product Result for
Synonyms: HSU79303 ZNF581
UniProtKB ID: Q9BWC9, B3KUF9, D3K183, Q99786
Gene ID:
Mouse(232821) coiled-coil domain containing 106
Rat(499071) coiled-coil domain containing 106
Zebrafish(503711) coiled-coil domain containing 106
domestic cat(101082961) coiled-coil domain containing 106
cow(618485) coiled-coil domain containing 106
dog(476376) coiled-coil domain containing 106
naked mole-rat(101724880) coiled-coil domain containing 106
domestic guinea pig(100713419) coiled-coil domain containing 106
sheep(101117695) coiled-coil domain containing 106
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013301 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050941 MISSION® esiRNA esiRNA human CCDC106 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013301 Rosetta Predictions human pricing
XM_001059637 Rosetta Predictions rat pricing
XM_574352 Rosetta Predictions rat pricing
NM_146178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156417 predicted 809
2 SASI_Hs01_00156418 predicted 1201
3 SASI_Hs01_00156419 predicted 1447
4 SASI_Hs02_00344580 predicted 1205
5 SASI_Hs01_00156421 predicted 1010
6 SASI_Hs02_00344581 predicted 811
7 SASI_Hs01_00156422 predicted 1561
8 SASI_Hs01_00156423 predicted 1037
9 SASI_Hs01_00156425 predicted 891
10 SASI_Hs01_00156426 predicted 775
11 SASI_Hs01_00156420 predicted 785
12 SASI_Hs01_00156424 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293807 predicted 1076
2 SASI_Rn02_00293808 predicted 313
3 SASI_Rn02_00293809 predicted 508
4 SASI_Rn02_00293810 predicted 511
5 SASI_Rn02_00293811 predicted 1224
6 SASI_Rn02_00293812 predicted 605
7 SASI_Rn02_00293813 predicted 404
8 SASI_Rn02_00293814 predicted 1091
9 SASI_Rn02_00293815 predicted 387
10 SASI_Rn02_00293816 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401821 predicted 309
2 SASI_Rn02_00401822 predicted 504
3 SASI_Rn02_00401823 predicted 590
4 SASI_Rn02_00401824 predicted 513
5 SASI_Rn02_00401825 predicted 405
6 SASI_Rn02_00401826 predicted 300
7 SASI_Rn02_00401827 predicted 293
8 SASI_Rn02_00401828 predicted 389
9 SASI_Rn02_00401829 predicted 614
10 SASI_Rn02_00401830 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199935 predicted 1551
2 SASI_Mm01_00199936 predicted 980
3 SASI_Mm01_00199937 predicted 1065
4 SASI_Mm01_00199942 predicted 1361
5 SASI_Mm02_00341878 predicted 1373
6 SASI_Mm01_00199939 predicted 1561
7 SASI_Mm01_00199940 predicted 986
8 SASI_Mm01_00199941 predicted 1329
9 SASI_Mm02_00341879 predicted 1155
10 SASI_Mm02_00341880 predicted 1119
11 SASI_Mm01_00199938 predicted 538
12 SASI_Mm01_00199943 predicted 904
13 SASI_Mm01_00199944 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013301
CCDC106 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 106
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-1004s21c1
Sequence:CCGGGGTGCCAGCTGGACAAATTCACTCGAGTGAATTTGTCCAGCTGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-817s21c1
Sequence:CCGGCACCTAGACCCACAGATCTTTCTCGAGAAAGATCTGTGGGTCTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-773s21c1
Sequence:CCGGACGATGAGACCTTCGAGATCTCTCGAGAGATCTCGAAGGTCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-1307s21c1
Sequence:CCGGGCACCTTCCAGAAGCTCAAGACTCGAGTCTTGAGCTTCTGGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-903s21c1
Sequence:CCGGTCTGATGAACAGCGTCAAGACCTCGAGGTCTTGACGCTGTTCATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013301.1-562s1c1
Sequence:CCGGCAGCTGGACAAATTCATCTCTCTCGAGAGAGATGAATTTGTCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013301.1-405s1c1
Sequence:CCGGCTCTCGGAGAAACTTCGAGGACTCGAGTCCTCGAAGTTTCTCCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013301
CCDC106 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 106
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-1004s21c1
Sequence:CCGGGGTGCCAGCTGGACAAATTCACTCGAGTGAATTTGTCCAGCTGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-817s21c1
Sequence:CCGGCACCTAGACCCACAGATCTTTCTCGAGAAAGATCTGTGGGTCTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-773s21c1
Sequence:CCGGACGATGAGACCTTCGAGATCTCTCGAGAGATCTCGAAGGTCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-1307s21c1
Sequence:CCGGGCACCTTCCAGAAGCTCAAGACTCGAGTCTTGAGCTTCTGGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-903s21c1
Sequence:CCGGTCTGATGAACAGCGTCAAGACCTCGAGGTCTTGACGCTGTTCATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013301.1-562s1c1
Sequence:CCGGCAGCTGGACAAATTCATCTCTCTCGAGAGAGATGAATTTGTCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013301.1-405s1c1
Sequence:CCGGCTCTCGGAGAAACTTCGAGGACTCGAGTCCTCGAAGTTTCTCCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013301
CCDC106 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 106
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-1004s21c1
Sequence:CCGGGGTGCCAGCTGGACAAATTCACTCGAGTGAATTTGTCCAGCTGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-817s21c1
Sequence:CCGGCACCTAGACCCACAGATCTTTCTCGAGAAAGATCTGTGGGTCTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-773s21c1
Sequence:CCGGACGATGAGACCTTCGAGATCTCTCGAGAGATCTCGAAGGTCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-1307s21c1
Sequence:CCGGGCACCTTCCAGAAGCTCAAGACTCGAGTCTTGAGCTTCTGGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013301.2-903s21c1
Sequence:CCGGTCTGATGAACAGCGTCAAGACCTCGAGGTCTTGACGCTGTTCATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013301.1-562s1c1
Sequence:CCGGCAGCTGGACAAATTCATCTCTCTCGAGAGAGATGAATTTGTCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013301.1-405s1c1
Sequence:CCGGCTCTCGGAGAAACTTCGAGGACTCGAGTCCTCGAAGTTTCTCCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146178
CCDC106 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 106
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-527s1c1
Sequence:CCGGCAAATCTTATACCGTCTGAGTCTCGAGACTCAGACGGTATAAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-867s1c1
Sequence:CCGGGAAGTGCCAGTGAAAGGAAGACTCGAGTCTTCCTTTCACTGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146178.1-916s1c1
Sequence:CCGGGAAGCGATTTGGGAAGACCAACTCGAGTTGGTCTTCCCAAATCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-890s1c1
Sequence:CCGGCAGAAGCAGAAGGGAAGTACTCTCGAGAGTACTTCCCTTCTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-874s1c1
Sequence:CCGGCAGTGAAAGGAAGAGGCAGAACTCGAGTTCTGCCTCTTCCTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-1006s1c1
Sequence:CCGGCTTCCAGAAGCTGAAGAGCATCTCGAGATGCTCTTCAGCTTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146178.1-476s1c1
Sequence:CCGGGAGACCTTTGAGATCTCCATTCTCGAGAATGGAGATCTCAAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146178
CCDC106 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 106
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-527s1c1
Sequence:CCGGCAAATCTTATACCGTCTGAGTCTCGAGACTCAGACGGTATAAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-867s1c1
Sequence:CCGGGAAGTGCCAGTGAAAGGAAGACTCGAGTCTTCCTTTCACTGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146178.1-916s1c1
Sequence:CCGGGAAGCGATTTGGGAAGACCAACTCGAGTTGGTCTTCCCAAATCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-890s1c1
Sequence:CCGGCAGAAGCAGAAGGGAAGTACTCTCGAGAGTACTTCCCTTCTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-874s1c1
Sequence:CCGGCAGTGAAAGGAAGAGGCAGAACTCGAGTTCTGCCTCTTCCTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-1006s1c1
Sequence:CCGGCTTCCAGAAGCTGAAGAGCATCTCGAGATGCTCTTCAGCTTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146178.1-476s1c1
Sequence:CCGGGAGACCTTTGAGATCTCCATTCTCGAGAATGGAGATCTCAAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146178
CCDC106 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 106
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-527s1c1
Sequence:CCGGCAAATCTTATACCGTCTGAGTCTCGAGACTCAGACGGTATAAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-867s1c1
Sequence:CCGGGAAGTGCCAGTGAAAGGAAGACTCGAGTCTTCCTTTCACTGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146178.1-916s1c1
Sequence:CCGGGAAGCGATTTGGGAAGACCAACTCGAGTTGGTCTTCCCAAATCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-890s1c1
Sequence:CCGGCAGAAGCAGAAGGGAAGTACTCTCGAGAGTACTTCCCTTCTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-874s1c1
Sequence:CCGGCAGTGAAAGGAAGAGGCAGAACTCGAGTTCTGCCTCTTCCTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146178.1-1006s1c1
Sequence:CCGGCTTCCAGAAGCTGAAGAGCATCTCGAGATGCTCTTCAGCTTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146178.1-476s1c1
Sequence:CCGGGAGACCTTTGAGATCTCCATTCTCGAGAATGGAGATCTCAAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks