EMAIL THIS PAGE TO A FRIEND

CCDC107

coiled-coil domain containing 107

69 Gene Product Result for
Synonyms: PSEC0222
Gene ID:
Human(203260) Summary: This gene encodes a membrane protein which contains a coiled-coil domain in the central region. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Mouse(622404) coiled-coil domain containing 107
Rat(313496) coiled-coil domain containing 107
sheep(101116205) coiled-coil domain containing 107
domestic guinea pig(100728334) coiled-coil domain containing 107
naked mole-rat(101722076) coiled-coil domain containing 107
chicken(417860) coiled-coil domain containing 107
cow(514786) coiled-coil domain containing 107
domestic cat(101087276) coiled-coil domain containing 107
dog(611925) coiled-coil domain containing 107
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174923 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106561 MISSION® esiRNA esiRNA human CCDC107 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174923 Rosetta Predictions human pricing
NM_001107957 Rosetta Predictions rat pricing
NM_001037913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096694 predicted 681
2 SASI_Hs01_00096695 predicted 616
3 SASI_Hs01_00096696 predicted 622
4 SASI_Hs01_00096697 predicted 560
5 SASI_Hs01_00096699 predicted 684
6 SASI_Hs01_00096700 predicted 381
7 SASI_Hs01_00096701 predicted 674
8 SASI_Hs01_00096702 predicted 420
9 SASI_Hs01_00096703 predicted 600
10 SASI_Hs02_00368848 predicted 505
11 SASI_Hs01_00096698 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233955 predicted 543
2 SASI_Rn02_00233956 predicted 579
3 SASI_Rn02_00233957 predicted 417
4 SASI_Rn02_00233958 predicted 686
5 SASI_Rn02_00233959 predicted 575
6 SASI_Rn02_00233960 predicted 516
7 SASI_Rn02_00233961 predicted 587
8 SASI_Rn02_00233962 predicted 474
9 SASI_Rn02_00233963 predicted 713
10 SASI_Rn02_00233964 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133332 predicted 448
2 SASI_Mm01_00133333 predicted 496
3 SASI_Mm01_00133334 predicted 489
4 SASI_Mm01_00133335 predicted 556
5 SASI_Mm01_00133336 predicted 462
6 SASI_Mm01_00133338 predicted 491
7 SASI_Mm01_00133339 predicted 328
8 SASI_Mm01_00133340 predicted 433
9 SASI_Mm01_00133341 predicted 223
10 SASI_Mm02_00289502 predicted 334
11 SASI_Mm01_00133337 predicted 537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174923
CCDC107 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 107
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-501s1c1
Sequence:CCGGGCAGGAGCTTCTGAACATGAACTCGAGTTCATGTTCAGAAGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-755s1c1
Sequence:CCGGCAAACTGGAGCACAGAGACATCTCGAGATGTCTCTGTGCTCCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-505s1c1
Sequence:CCGGGAGCTTCTGAACATGAAGCTACTCGAGTAGCTTCATGTTCAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-513s1c1
Sequence:CCGGGAACATGAAGCTATGGACCATCTCGAGATGGTCCATAGCTTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-327s1c1
Sequence:CCGGGAAAGATGAAACTGCGGTTCTCTCGAGAGAACCGCAGTTTCATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174923.1-423s21c1
Sequence:CCGGGACAGAGCAGCACCTGAACAACTCGAGTTGTTCAGGTGCTGCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174923.1-469s21c1
Sequence:CCGGTTTGAGCGTGTGACTACTCTGCTCGAGCAGAGTAGTCACACGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174923.1-879s21c1
Sequence:CCGGGACAGCTGAAGGTCGACTAAACTCGAGTTTAGTCGACCTTCAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174923
CCDC107 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 107
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-501s1c1
Sequence:CCGGGCAGGAGCTTCTGAACATGAACTCGAGTTCATGTTCAGAAGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-755s1c1
Sequence:CCGGCAAACTGGAGCACAGAGACATCTCGAGATGTCTCTGTGCTCCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-505s1c1
Sequence:CCGGGAGCTTCTGAACATGAAGCTACTCGAGTAGCTTCATGTTCAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-513s1c1
Sequence:CCGGGAACATGAAGCTATGGACCATCTCGAGATGGTCCATAGCTTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-327s1c1
Sequence:CCGGGAAAGATGAAACTGCGGTTCTCTCGAGAGAACCGCAGTTTCATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174923.1-423s21c1
Sequence:CCGGGACAGAGCAGCACCTGAACAACTCGAGTTGTTCAGGTGCTGCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174923.1-469s21c1
Sequence:CCGGTTTGAGCGTGTGACTACTCTGCTCGAGCAGAGTAGTCACACGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174923.1-879s21c1
Sequence:CCGGGACAGCTGAAGGTCGACTAAACTCGAGTTTAGTCGACCTTCAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174923
CCDC107 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 107
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-501s1c1
Sequence:CCGGGCAGGAGCTTCTGAACATGAACTCGAGTTCATGTTCAGAAGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-755s1c1
Sequence:CCGGCAAACTGGAGCACAGAGACATCTCGAGATGTCTCTGTGCTCCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-505s1c1
Sequence:CCGGGAGCTTCTGAACATGAAGCTACTCGAGTAGCTTCATGTTCAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-513s1c1
Sequence:CCGGGAACATGAAGCTATGGACCATCTCGAGATGGTCCATAGCTTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174923.1-327s1c1
Sequence:CCGGGAAAGATGAAACTGCGGTTCTCTCGAGAGAACCGCAGTTTCATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174923.1-423s21c1
Sequence:CCGGGACAGAGCAGCACCTGAACAACTCGAGTTGTTCAGGTGCTGCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174923.1-469s21c1
Sequence:CCGGTTTGAGCGTGTGACTACTCTGCTCGAGCAGAGTAGTCACACGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174923.1-879s21c1
Sequence:CCGGGACAGCTGAAGGTCGACTAAACTCGAGTTTAGTCGACCTTCAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037913
VALIDATED
CCDC107 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 107
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-496s21c1
Sequence:CCGGGACCATCCACCACCTTCTACACTCGAGTGTAGAAGGTGGTGGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-269s21c1
Sequence:CCGGTTTGTGCTGTTCAAGTGTTTGCTCGAGCAAACACTTGAACAGCACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-461s21c1
Sequence:CCGGGGAACCCAGAGGGAACTTCTACTCGAGTAGAAGTTCCCTCTGGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-555s21c1
Sequence:CCGGCAGAGGCCAGCATACCCTTTACTCGAGTAAAGGGTATGCTGGCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-438s21c1
Sequence:CCGGTTGAACAGGTGACGACTTTGGCTCGAGCCAAAGTCGTCACCTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037913
VALIDATED
CCDC107 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 107
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-496s21c1
Sequence:CCGGGACCATCCACCACCTTCTACACTCGAGTGTAGAAGGTGGTGGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-269s21c1
Sequence:CCGGTTTGTGCTGTTCAAGTGTTTGCTCGAGCAAACACTTGAACAGCACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-461s21c1
Sequence:CCGGGGAACCCAGAGGGAACTTCTACTCGAGTAGAAGTTCCCTCTGGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-555s21c1
Sequence:CCGGCAGAGGCCAGCATACCCTTTACTCGAGTAAAGGGTATGCTGGCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-438s21c1
Sequence:CCGGTTGAACAGGTGACGACTTTGGCTCGAGCCAAAGTCGTCACCTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037913
VALIDATED
CCDC107 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 107
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-496s21c1
Sequence:CCGGGACCATCCACCACCTTCTACACTCGAGTGTAGAAGGTGGTGGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-269s21c1
Sequence:CCGGTTTGTGCTGTTCAAGTGTTTGCTCGAGCAAACACTTGAACAGCACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-461s21c1
Sequence:CCGGGGAACCCAGAGGGAACTTCTACTCGAGTAGAAGTTCCCTCTGGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-555s21c1
Sequence:CCGGCAGAGGCCAGCATACCCTTTACTCGAGTAAAGGGTATGCTGGCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037913.1-438s21c1
Sequence:CCGGTTGAACAGGTGACGACTTTGGCTCGAGCCAAAGTCGTCACCTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks