EMAIL THIS PAGE TO A FRIEND

CCDC108

coiled-coil domain containing 108

45 Gene Product Result for
UniProtKB ID: Q6ZU64, A2BDD8, E9PCR1, Q6ZSR8, Q8N0T4, Q8NDJ3
Gene ID:
Mouse(241116) coiled-coil domain containing 108
chicken(424206) coiled-coil domain containing 108
cow(519807) coiled-coil domain containing 108
Horse(100058974) coiled-coil domain containing 108
dog(488532) coiled-coil domain containing 108
domestic cat(101099894) coiled-coil domain containing 108
naked mole-rat(101697821) coiled-coil domain containing 108
domestic guinea pig(101787485) coiled-coil domain containing 108
sheep(101112547) coiled-coil domain containing 108
Domestic Rabbit(100349492) coiled-coil domain containing 108
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194302 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026911 MISSION® esiRNA esiRNA human CCDC108 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152389 Rosetta Predictions human pricing
NM_194302 Rosetta Predictions human pricing
NM_001039495 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198646 predicted 284
2 SASI_Hs01_00198647 predicted 199
3 SASI_Hs01_00198649 predicted 290
4 SASI_Hs01_00198650 predicted 196
5 SASI_Hs01_00198652 predicted 273
6 SASI_Hs01_00198653 predicted 247
7 SASI_Hs01_00198654 predicted 286
8 SASI_Hs01_00198655 predicted 233
9 SASI_Hs02_00366060 predicted 742
10 SASI_Hs02_00366061 predicted 738
11 SASI_Hs01_00198648 predicted 253
12 SASI_Hs01_00198651 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182720 predicted 2371
2 SASI_Hs01_00182721 predicted 4343
3 SASI_Hs01_00182722 predicted 2873
4 SASI_Hs01_00182723 predicted 5105
5 SASI_Hs01_00182724 predicted 764
6 SASI_Hs01_00182725 predicted 1438
7 SASI_Hs01_00182726 predicted 2936
8 SASI_Hs01_00182728 predicted 1854
9 SASI_Hs01_00182729 predicted 4583
10 SASI_Hs02_00371445 predicted 4657
11 SASI_Hs01_00182727 predicted 4043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188429 predicted 1020
2 SASI_Mm01_00188430 predicted 1547
3 SASI_Mm01_00188431 predicted 3245
4 SASI_Mm01_00188432 predicted 2083
5 SASI_Mm01_00188433 predicted 2852
6 SASI_Mm01_00188434 predicted 3583
7 SASI_Mm01_00188435 predicted 4461
8 SASI_Mm01_00188438 predicted 1730
9 SASI_Mm02_00290080 predicted 4477
10 SASI_Mm02_00290081 predicted 2627
11 SASI_Mm01_00188436 predicted 1297
12 SASI_Mm01_00188437 predicted 1861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194302
CCDC108 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 108
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194302.2-5215s21c1
Sequence:CCGGTGGAATGAGCAGTCAACTAAGCTCGAGCTTAGTTGACTGCTCATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194302.2-133s21c1
Sequence:CCGGGAGAATCCATCAGTCTCATTTCTCGAGAAATGAGACTGATGGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194302.2-3142s21c1
Sequence:CCGGGGCAACTGCACCCTCTATTACCTCGAGGTAATAGAGGGTGCAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-2284s1c1
Sequence:CCGGCCTCAACAACATCTCCAAGAACTCGAGTTCTTGGAGATGTTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-2770s1c1
Sequence:CCGGCGACTACTTTCTGGCTAACTTCTCGAGAAGTTAGCCAGAAAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194302.1-3073s1c1
Sequence:CCGGCCTGTACTTAATGCCAATCCTCTCGAGAGGATTGGCATTAAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-3070s1c1
Sequence:CCGGCAGCCTGTACTTAATGCCAATCTCGAGATTGGCATTAAGTACAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-1853s1c1
Sequence:CCGGCGGCAGATTTATGAGCTGTATCTCGAGATACAGCTCATAAATCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-2956s1c1
Sequence:CCGGCCTGCTGGAAGACAAGAACTTCTCGAGAAGTTCTTGTCTTCCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194302.1-901s1c1
Sequence:CCGGCTTTGGGAATGTGCTGGTGAACTCGAGTTCACCAGCACATTCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194302.1-298s1c1
Sequence:CCGGCCTGGTCAACAAAGACTGCAACTCGAGTTGCAGTCTTTGTTGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194302
CCDC108 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 108
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194302.2-5215s21c1
Sequence:CCGGTGGAATGAGCAGTCAACTAAGCTCGAGCTTAGTTGACTGCTCATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194302.2-133s21c1
Sequence:CCGGGAGAATCCATCAGTCTCATTTCTCGAGAAATGAGACTGATGGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194302.2-3142s21c1
Sequence:CCGGGGCAACTGCACCCTCTATTACCTCGAGGTAATAGAGGGTGCAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-2284s1c1
Sequence:CCGGCCTCAACAACATCTCCAAGAACTCGAGTTCTTGGAGATGTTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-2770s1c1
Sequence:CCGGCGACTACTTTCTGGCTAACTTCTCGAGAAGTTAGCCAGAAAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194302.1-3073s1c1
Sequence:CCGGCCTGTACTTAATGCCAATCCTCTCGAGAGGATTGGCATTAAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-3070s1c1
Sequence:CCGGCAGCCTGTACTTAATGCCAATCTCGAGATTGGCATTAAGTACAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-1853s1c1
Sequence:CCGGCGGCAGATTTATGAGCTGTATCTCGAGATACAGCTCATAAATCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-2956s1c1
Sequence:CCGGCCTGCTGGAAGACAAGAACTTCTCGAGAAGTTCTTGTCTTCCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194302.1-901s1c1
Sequence:CCGGCTTTGGGAATGTGCTGGTGAACTCGAGTTCACCAGCACATTCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194302.1-298s1c1
Sequence:CCGGCCTGGTCAACAAAGACTGCAACTCGAGTTGCAGTCTTTGTTGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194302
CCDC108 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 108
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194302.2-5215s21c1
Sequence:CCGGTGGAATGAGCAGTCAACTAAGCTCGAGCTTAGTTGACTGCTCATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194302.2-133s21c1
Sequence:CCGGGAGAATCCATCAGTCTCATTTCTCGAGAAATGAGACTGATGGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194302.2-3142s21c1
Sequence:CCGGGGCAACTGCACCCTCTATTACCTCGAGGTAATAGAGGGTGCAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-2284s1c1
Sequence:CCGGCCTCAACAACATCTCCAAGAACTCGAGTTCTTGGAGATGTTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-2770s1c1
Sequence:CCGGCGACTACTTTCTGGCTAACTTCTCGAGAAGTTAGCCAGAAAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194302.1-3073s1c1
Sequence:CCGGCCTGTACTTAATGCCAATCCTCTCGAGAGGATTGGCATTAAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-3070s1c1
Sequence:CCGGCAGCCTGTACTTAATGCCAATCTCGAGATTGGCATTAAGTACAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-1853s1c1
Sequence:CCGGCGGCAGATTTATGAGCTGTATCTCGAGATACAGCTCATAAATCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194302.1-2956s1c1
Sequence:CCGGCCTGCTGGAAGACAAGAACTTCTCGAGAAGTTCTTGTCTTCCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194302.1-901s1c1
Sequence:CCGGCTTTGGGAATGTGCTGGTGAACTCGAGTTCACCAGCACATTCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194302.1-298s1c1
Sequence:CCGGCCTGGTCAACAAAGACTGCAACTCGAGTTGCAGTCTTTGTTGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039495
CCDC108 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 108
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-2093s21c1
Sequence:CCGGAGAAGCCTTCGCCGTTTATAACTCGAGTTATAAACGGCGAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-2960s21c1
Sequence:CCGGCGGCAACTGCACCCTCTATTACTCGAGTAATAGAGGGTGCAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-5355s21c1
Sequence:CCGGCAGGATCTGAAGACCATAATACTCGAGTATTATGGTCTTCAGATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-4492s21c1
Sequence:CCGGGGGAACTTATGCGGCAGTATCCTCGAGGATACTGCCGCATAAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-4467s21c1
Sequence:CCGGGACTTGATATGCAAGGTATACCTCGAGGTATACCTTGCATATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039495
CCDC108 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 108
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-2093s21c1
Sequence:CCGGAGAAGCCTTCGCCGTTTATAACTCGAGTTATAAACGGCGAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-2960s21c1
Sequence:CCGGCGGCAACTGCACCCTCTATTACTCGAGTAATAGAGGGTGCAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-5355s21c1
Sequence:CCGGCAGGATCTGAAGACCATAATACTCGAGTATTATGGTCTTCAGATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-4492s21c1
Sequence:CCGGGGGAACTTATGCGGCAGTATCCTCGAGGATACTGCCGCATAAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-4467s21c1
Sequence:CCGGGACTTGATATGCAAGGTATACCTCGAGGTATACCTTGCATATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039495
CCDC108 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 108
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-2093s21c1
Sequence:CCGGAGAAGCCTTCGCCGTTTATAACTCGAGTTATAAACGGCGAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-2960s21c1
Sequence:CCGGCGGCAACTGCACCCTCTATTACTCGAGTAATAGAGGGTGCAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-5355s21c1
Sequence:CCGGCAGGATCTGAAGACCATAATACTCGAGTATTATGGTCTTCAGATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-4492s21c1
Sequence:CCGGGGGAACTTATGCGGCAGTATCCTCGAGGATACTGCCGCATAAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039495.1-4467s21c1
Sequence:CCGGGACTTGATATGCAAGGTATACCTCGAGGTATACCTTGCATATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks