EMAIL THIS PAGE TO A FRIEND

CCDC109B

coiled-coil domain containing 109B

56 Gene Product Result for
UniProtKB ID: Q9NWR8, A8K4Y3, Q6IAC1
Gene ID:
Mouse(66815) coiled-coil domain containing 109B
Rat(295462) coiled-coil domain containing 109B
chicken(422698) coiled-coil domain containing 109B
cow(504728) coiled-coil domain containing 109B
domestic cat(101086903) coiled-coil domain containing 109B
dog(478513) coiled-coil domain containing 109B
sheep(101120082) coiled-coil domain containing 109B
domestic guinea pig(100713088) coiled-coil domain containing 109B
naked mole-rat(101706115) coiled-coil domain containing 109B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017918 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017918 Rosetta Predictions human pricing
XM_001076863 Rosetta Predictions rat pricing
XM_215707 Rosetta Predictions rat pricing
NM_025779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142431 predicted 533
2 SASI_Hs01_00142432 predicted 967
3 SASI_Hs01_00142433 predicted 546
4 SASI_Hs01_00142434 predicted 416
5 SASI_Hs01_00142435 predicted 819
6 SASI_Hs01_00142436 predicted 791
7 SASI_Hs02_00350906 predicted 892
8 SASI_Hs01_00142437 predicted 882
9 SASI_Hs01_00142438 predicted 913
10 SASI_Hs01_00142439 predicted 881
11 SASI_Hs01_00142440 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354832 predicted 985
2 SASI_Rn02_00354833 predicted 974
3 SASI_Rn02_00354834 predicted 632
4 SASI_Rn02_00354835 predicted 428
5 SASI_Rn02_00354836 predicted 683
6 SASI_Rn02_00354837 predicted 845
7 SASI_Rn02_00354838 predicted 1040
8 SASI_Rn02_00354839 predicted 504
9 SASI_Rn02_00354840 predicted 1134
10 SASI_Rn02_00354841 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376145 predicted 441
2 SASI_Rn02_00376146 predicted 431
3 SASI_Rn02_00376147 predicted 482
4 SASI_Rn02_00376148 predicted 371
5 SASI_Rn02_00376149 predicted 399
6 SASI_Rn02_00376150 predicted 448
7 SASI_Rn02_00376151 predicted 365
8 SASI_Rn02_00376152 predicted 460
9 SASI_Rn02_00376153 predicted 366
10 SASI_Rn02_00376154 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054946 predicted 587
2 SASI_Mm01_00054947 predicted 537
3 SASI_Mm01_00054948 predicted 885
4 SASI_Mm02_00328997 predicted 260
5 SASI_Mm01_00054949 predicted 573
6 SASI_Mm01_00054950 predicted 507
7 SASI_Mm01_00054951 predicted 399
8 SASI_Mm01_00054952 predicted 621
9 SASI_Mm01_00054953 predicted 568
10 SASI_Mm01_00054955 predicted 436
11 SASI_Mm01_00054954 predicted 766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017918
VALIDATED
CCDC109B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 109B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_017918.3-1058s1c1
Sequence:CCGGGCAAGTAGAAGAACTCAATGACTCGAGTCATTGAGTTCTTCTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_017918.3-431s1c1
Sequence:CCGGCATGATTTCAGCTTCTACCTTCTCGAGAAGGTAGAAGCTGAAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_017918.3-441s1c1
Sequence:CCGGGCTTCTACCTTGATGGATATTCTCGAGAATATCCATCAAGGTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017918.3-907s1c1
Sequence:CCGGCAGCTGTTAAGAGTAGGCAATCTCGAGATTGCCTACTCTTAACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A3
TRC Version: 1 Clone ID:NM_017918.3-909s1c1
Sequence:CCGGGCTGTTAAGAGTAGGCAATTTCTCGAGAAATTGCCTACTCTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017918.3-427s1c1
Sequence:CCGGGCAACATGATTTCAGCTTCTACTCGAGTAGAAGCTGAAATCATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017918.4-1058s21c1
Sequence:CCGGGAAGACCTTGCTAAGGCTAAACTCGAGTTTAGCCTTAGCAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017918.4-1035s21c1
Sequence:CCGCTGCAGCAATACAACAAGTTAACTCGAGTTAACTTGTTGTATTGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017918
VALIDATED
CCDC109B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 109B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_017918.3-1058s1c1
Sequence:CCGGGCAAGTAGAAGAACTCAATGACTCGAGTCATTGAGTTCTTCTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_017918.3-431s1c1
Sequence:CCGGCATGATTTCAGCTTCTACCTTCTCGAGAAGGTAGAAGCTGAAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_017918.3-441s1c1
Sequence:CCGGGCTTCTACCTTGATGGATATTCTCGAGAATATCCATCAAGGTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017918.3-907s1c1
Sequence:CCGGCAGCTGTTAAGAGTAGGCAATCTCGAGATTGCCTACTCTTAACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A3
TRC Version: 1 Clone ID:NM_017918.3-909s1c1
Sequence:CCGGGCTGTTAAGAGTAGGCAATTTCTCGAGAAATTGCCTACTCTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017918.3-427s1c1
Sequence:CCGGGCAACATGATTTCAGCTTCTACTCGAGTAGAAGCTGAAATCATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017918.4-1058s21c1
Sequence:CCGGGAAGACCTTGCTAAGGCTAAACTCGAGTTTAGCCTTAGCAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017918.4-1035s21c1
Sequence:CCGCTGCAGCAATACAACAAGTTAACTCGAGTTAACTTGTTGTATTGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017918
VALIDATED
CCDC109B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 109B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_017918.3-1058s1c1
Sequence:CCGGGCAAGTAGAAGAACTCAATGACTCGAGTCATTGAGTTCTTCTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_017918.3-431s1c1
Sequence:CCGGCATGATTTCAGCTTCTACCTTCTCGAGAAGGTAGAAGCTGAAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_017918.3-441s1c1
Sequence:CCGGGCTTCTACCTTGATGGATATTCTCGAGAATATCCATCAAGGTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017918.3-907s1c1
Sequence:CCGGCAGCTGTTAAGAGTAGGCAATCTCGAGATTGCCTACTCTTAACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A3
TRC Version: 1 Clone ID:NM_017918.3-909s1c1
Sequence:CCGGGCTGTTAAGAGTAGGCAATTTCTCGAGAAATTGCCTACTCTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017918.3-427s1c1
Sequence:CCGGGCAACATGATTTCAGCTTCTACTCGAGTAGAAGCTGAAATCATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017918.4-1058s21c1
Sequence:CCGGGAAGACCTTGCTAAGGCTAAACTCGAGTTTAGCCTTAGCAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017918.4-1035s21c1
Sequence:CCGCTGCAGCAATACAACAAGTTAACTCGAGTTAACTTGTTGTATTGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025779
VALIDATED
CCDC109B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 109B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025779.2-653s1c1
Sequence:CCGGGTCCTTGGTTCACAGACTATTCTCGAGAATAGTCTGTGAACCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025779.2-404s1c1
Sequence:CCGGCCAGTTTGTAGTCAAGCCGATCTCGAGATCGGCTTGACTACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025779.2-566s1c1
Sequence:CCGGCATCATTAACAAACTACGGTACTCGAGTACCGTAGTTTGTTAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025779.2-909s1c1
Sequence:CCGGGTTACCTTCTTCCTGTCGTTTCTCGAGAAACGACAGGAAGAAGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025779.2-1205s1c1
Sequence:CCGGCTGATAGCTTACCAACTGGATCTCGAGATCCAGTTGGTAAGCTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025779.3-1056s1c1
Sequence:CCGGGAACAATACAACAAGCTAAAGCTCGAGCTTTAGCTTGTTGTATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025779.3-1011s1c1
Sequence:CCGGCTTCAGTTCTTCCACAAGAAACTCGAGTTTCTTGTGGAAGAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025779
VALIDATED
CCDC109B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 109B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025779.2-653s1c1
Sequence:CCGGGTCCTTGGTTCACAGACTATTCTCGAGAATAGTCTGTGAACCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025779.2-404s1c1
Sequence:CCGGCCAGTTTGTAGTCAAGCCGATCTCGAGATCGGCTTGACTACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025779.2-566s1c1
Sequence:CCGGCATCATTAACAAACTACGGTACTCGAGTACCGTAGTTTGTTAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025779.2-909s1c1
Sequence:CCGGGTTACCTTCTTCCTGTCGTTTCTCGAGAAACGACAGGAAGAAGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025779.2-1205s1c1
Sequence:CCGGCTGATAGCTTACCAACTGGATCTCGAGATCCAGTTGGTAAGCTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025779.3-1056s1c1
Sequence:CCGGGAACAATACAACAAGCTAAAGCTCGAGCTTTAGCTTGTTGTATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025779.3-1011s1c1
Sequence:CCGGCTTCAGTTCTTCCACAAGAAACTCGAGTTTCTTGTGGAAGAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025779
VALIDATED
CCDC109B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 109B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025779.2-653s1c1
Sequence:CCGGGTCCTTGGTTCACAGACTATTCTCGAGAATAGTCTGTGAACCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025779.2-404s1c1
Sequence:CCGGCCAGTTTGTAGTCAAGCCGATCTCGAGATCGGCTTGACTACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025779.2-566s1c1
Sequence:CCGGCATCATTAACAAACTACGGTACTCGAGTACCGTAGTTTGTTAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025779.2-909s1c1
Sequence:CCGGGTTACCTTCTTCCTGTCGTTTCTCGAGAAACGACAGGAAGAAGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025779.2-1205s1c1
Sequence:CCGGCTGATAGCTTACCAACTGGATCTCGAGATCCAGTTGGTAAGCTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025779.3-1056s1c1
Sequence:CCGGGAACAATACAACAAGCTAAAGCTCGAGCTTTAGCTTGTTGTATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025779.3-1011s1c1
Sequence:CCGGCTTCAGTTCTTCCACAAGAAACTCGAGTTTCTTGTGGAAGAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks