EMAIL THIS PAGE TO A FRIEND

CCDC110

coiled-coil domain containing 110

67 Gene Product Result for
Synonyms: CT52 KM-HN-1 KMHN1
UniProtKB ID: Q8TBZ0, Q86YI9, Q8N7W0
Gene ID:
Mouse(212392) coiled-coil domain containing 110
Rat(290755) coiled-coil domain containing 110
chicken(428777) coiled-coil domain containing 110
cow(790027) coiled-coil domain containing 110
domestic cat(101097061) coiled-coil domain containing 110
dog(475626) coiled-coil domain containing 110
chicken(101666301) coiled-coil domain containing 110
chicken(101750861) coiled-coil domain containing 110
sheep(101109769) coiled-coil domain containing 110
domestic guinea pig(100716635) coiled-coil domain containing 110
naked mole-rat(101713960) coiled-coil domain containing 110
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152775 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152775 Rosetta Predictions human pricing
XM_214351 Rosetta Predictions rat pricing
XR_007910 Rosetta Predictions rat pricing
NM_001033246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032319 predicted 659
2 SASI_Hs01_00032320 predicted 2132
3 SASI_Hs01_00032321 predicted 550
4 SASI_Hs01_00032322 predicted 2530
5 SASI_Hs01_00032324 predicted 535
6 SASI_Hs01_00032325 predicted 435
7 SASI_Hs01_00032326 predicted 502
8 SASI_Hs01_00032327 predicted 2031
9 SASI_Hs01_00032328 predicted 2578
10 SASI_Hs02_00366716 predicted 1969
11 SASI_Hs01_00032323 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375250 predicted 347
2 SASI_Rn02_00375251 predicted 306
3 SASI_Rn02_00375252 predicted 344
4 SASI_Rn02_00375253 predicted 344
5 SASI_Rn02_00375254 predicted 420
6 SASI_Rn02_00375255 predicted 354
7 SASI_Rn02_00375256 predicted 407
8 SASI_Rn02_00375257 predicted 356
9 SASI_Rn02_00375258 predicted 354
10 SASI_Rn02_00375259 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00415785 predicted 483
2 SASI_Rn02_00415786 predicted 483
3 SASI_Rn02_00415787 predicted 519
4 SASI_Rn02_00415788 predicted 524
5 SASI_Rn02_00415789 predicted 624
6 SASI_Rn02_00415790 predicted 594
7 SASI_Rn02_00415791 predicted 525
8 SASI_Rn02_00415792 predicted 606
9 SASI_Rn02_00415793 predicted 579
10 SASI_Rn02_00415794 predicted 533
11 SASI_Rn01_00130078 predicted 1833
12 SASI_Rn01_00130079 predicted 2162
13 SASI_Rn01_00130080 predicted 1748
14 SASI_Rn01_00130081 predicted 2183
15 SASI_Rn01_00130082 predicted 2100
16 SASI_Rn01_00130083 predicted 1770
17 SASI_Rn01_00130084 predicted 2245
18 SASI_Rn01_00130085 predicted 2062
19 SASI_Rn01_00130086 predicted 2040
20 SASI_Rn01_00130087 predicted 1543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068824 predicted 1479
2 SASI_Mm01_00068825 predicted 854
3 SASI_Mm01_00068826 predicted 980
4 SASI_Mm02_00288401 predicted 861
5 SASI_Mm02_00288402 predicted 897
6 SASI_Mm01_00068827 predicted 827
7 SASI_Mm01_00068828 predicted 586
8 SASI_Mm01_00068829 predicted 462
9 SASI_Mm01_00068832 predicted 806
10 SASI_Mm02_00288403 predicted 2076
11 SASI_Mm01_00068830 predicted 349
12 SASI_Mm01_00068831 predicted 1786
13 SASI_Mm01_00068833 predicted 2062
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152775
CCDC110 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 110
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152775.1-163s1c1
Sequence:CCGGGCTGCATAGCAGAATCAGAAACTCGAGTTTCTGATTCTGCTATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152775.1-282s1c1
Sequence:CCGGCAGTCGGAAATCAGTGAAATACTCGAGTATTTCACTGATTTCCGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152775.1-227s1c1
Sequence:CCGGGTTGGAATCATTTCAGGCTTTCTCGAGAAAGCCTGAAATGATTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152775.1-2333s1c1
Sequence:CCGGGCGGCATCTTCAACGAGAATACTCGAGTATTCTCGTTGAAGATGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152775.1-1013s1c1
Sequence:CCGGCTTCAGGGAAACTGTGTCAAACTCGAGTTTGACACAGTTTCCCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152775.1-684s1c1
Sequence:CCGGGCTGATACAGTAATTCTGGATCTCGAGATCCAGAATTACTGTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152775.1-2571s1c1
Sequence:CCGGCTTCGAGAAATAGCCAATGTTCTCGAGAACATTGGCTATTTCTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152775.1-2680s1c1
Sequence:CCGGCAGAATGGTTTGGTGCAGATACTCGAGTATCTGCACCAAACCATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152775.3-2476s21c1
Sequence:CCGGCAACTATACTCACGAAGATACCTCGAGGTATCTTCGTGAGTATAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152775.3-1539s21c1
Sequence:CCGGGTACTATTCAGTCTAAGTTAACTCGAGTTAACTTAGACTGAATAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152775.3-1363s21c1
Sequence:CCGGGTACTTACAGAATTACCTAAACTCGAGTTTAGGTAATTCTGTAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152775.3-2674s21c1
Sequence:CCGGCTCATAATGAGGCGCTATATACTCGAGTATATAGCGCCTCATTATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152775
CCDC110 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 110
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152775.1-163s1c1
Sequence:CCGGGCTGCATAGCAGAATCAGAAACTCGAGTTTCTGATTCTGCTATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152775.1-282s1c1
Sequence:CCGGCAGTCGGAAATCAGTGAAATACTCGAGTATTTCACTGATTTCCGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152775.1-227s1c1
Sequence:CCGGGTTGGAATCATTTCAGGCTTTCTCGAGAAAGCCTGAAATGATTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152775.1-2333s1c1
Sequence:CCGGGCGGCATCTTCAACGAGAATACTCGAGTATTCTCGTTGAAGATGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152775.1-1013s1c1
Sequence:CCGGCTTCAGGGAAACTGTGTCAAACTCGAGTTTGACACAGTTTCCCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152775.1-684s1c1
Sequence:CCGGGCTGATACAGTAATTCTGGATCTCGAGATCCAGAATTACTGTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152775.1-2571s1c1
Sequence:CCGGCTTCGAGAAATAGCCAATGTTCTCGAGAACATTGGCTATTTCTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152775.1-2680s1c1
Sequence:CCGGCAGAATGGTTTGGTGCAGATACTCGAGTATCTGCACCAAACCATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152775.3-2476s21c1
Sequence:CCGGCAACTATACTCACGAAGATACCTCGAGGTATCTTCGTGAGTATAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152775.3-1539s21c1
Sequence:CCGGGTACTATTCAGTCTAAGTTAACTCGAGTTAACTTAGACTGAATAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152775.3-1363s21c1
Sequence:CCGGGTACTTACAGAATTACCTAAACTCGAGTTTAGGTAATTCTGTAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152775.3-2674s21c1
Sequence:CCGGCTCATAATGAGGCGCTATATACTCGAGTATATAGCGCCTCATTATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152775
CCDC110 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 110
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152775.1-163s1c1
Sequence:CCGGGCTGCATAGCAGAATCAGAAACTCGAGTTTCTGATTCTGCTATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152775.1-282s1c1
Sequence:CCGGCAGTCGGAAATCAGTGAAATACTCGAGTATTTCACTGATTTCCGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152775.1-227s1c1
Sequence:CCGGGTTGGAATCATTTCAGGCTTTCTCGAGAAAGCCTGAAATGATTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152775.1-2333s1c1
Sequence:CCGGGCGGCATCTTCAACGAGAATACTCGAGTATTCTCGTTGAAGATGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152775.1-1013s1c1
Sequence:CCGGCTTCAGGGAAACTGTGTCAAACTCGAGTTTGACACAGTTTCCCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152775.1-684s1c1
Sequence:CCGGGCTGATACAGTAATTCTGGATCTCGAGATCCAGAATTACTGTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152775.1-2571s1c1
Sequence:CCGGCTTCGAGAAATAGCCAATGTTCTCGAGAACATTGGCTATTTCTCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152775.1-2680s1c1
Sequence:CCGGCAGAATGGTTTGGTGCAGATACTCGAGTATCTGCACCAAACCATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152775.3-2476s21c1
Sequence:CCGGCAACTATACTCACGAAGATACCTCGAGGTATCTTCGTGAGTATAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152775.3-1539s21c1
Sequence:CCGGGTACTATTCAGTCTAAGTTAACTCGAGTTAACTTAGACTGAATAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152775.3-1363s21c1
Sequence:CCGGGTACTTACAGAATTACCTAAACTCGAGTTTAGGTAATTCTGTAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152775.3-2674s21c1
Sequence:CCGGCTCATAATGAGGCGCTATATACTCGAGTATATAGCGCCTCATTATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033246
CCDC110 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 110
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-1781s21c1
Sequence:CCGGCAGTAGAATGAACATAGAAATCTCGAGATTTCTATGTTCATTCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-724s21c1
Sequence:CCGGCTCCCGTGATTCTGGATAAATCTCGAGATTTATCCAGAATCACGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-1002s21c1
Sequence:CCGGTCGAAGAGAATTTCCGAATTACTCGAGTAATTCGGAAATTCTCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-593s21c1
Sequence:CCGGCCTGAGAACTACCGCTGATAACTCGAGTTATCAGCGGTAGTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-2213s21c1
Sequence:CCGGCATGGAGATTAAGGCGGATAACTCGAGTTATCCGCCTTAATCTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033246
CCDC110 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 110
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-1781s21c1
Sequence:CCGGCAGTAGAATGAACATAGAAATCTCGAGATTTCTATGTTCATTCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-724s21c1
Sequence:CCGGCTCCCGTGATTCTGGATAAATCTCGAGATTTATCCAGAATCACGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-1002s21c1
Sequence:CCGGTCGAAGAGAATTTCCGAATTACTCGAGTAATTCGGAAATTCTCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-593s21c1
Sequence:CCGGCCTGAGAACTACCGCTGATAACTCGAGTTATCAGCGGTAGTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-2213s21c1
Sequence:CCGGCATGGAGATTAAGGCGGATAACTCGAGTTATCCGCCTTAATCTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033246
CCDC110 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 110
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-1781s21c1
Sequence:CCGGCAGTAGAATGAACATAGAAATCTCGAGATTTCTATGTTCATTCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-724s21c1
Sequence:CCGGCTCCCGTGATTCTGGATAAATCTCGAGATTTATCCAGAATCACGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-1002s21c1
Sequence:CCGGTCGAAGAGAATTTCCGAATTACTCGAGTAATTCGGAAATTCTCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-593s21c1
Sequence:CCGGCCTGAGAACTACCGCTGATAACTCGAGTTATCAGCGGTAGTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033246.2-2213s21c1
Sequence:CCGGCATGGAGATTAAGGCGGATAACTCGAGTTATCCGCCTTAATCTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)