EMAIL THIS PAGE TO A FRIEND

CCDC111

coiled-coil domain containing 111

59 Gene Product Result for
UniProtKB ID: Q96LW4, D3DP55, Q5HYJ9
Gene ID:
Mouse(408022) coiled-coil domain containing 111
Rat(361147) coiled-coil domain containing 111
naked mole-rat(101703853) coiled-coil domain containing 111
domestic guinea pig(100721241) coiled-coil domain containing 111
sheep(101110117) coiled-coil domain containing 111
Domestic Rabbit(100342519) coiled-coil domain containing 111
chicken(422549) coiled-coil domain containing 111
domestic cat(101095573) coiled-coil domain containing 111
Horse(100058061) coiled-coil domain containing 111
cow(511080) coiled-coil domain containing 111
dog(475632) coiled-coil domain containing 111
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105571 MISSION® esiRNA esiRNA human CCDC111 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152683 Rosetta Predictions human pricing
XM_001060721 Rosetta Predictions rat pricing
XM_341433 Rosetta Predictions rat pricing
NM_001001184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172073 predicted 935
2 SASI_Hs01_00172074 predicted 1680
3 SASI_Hs01_00172075 predicted 1722
4 SASI_Hs02_00366577 predicted 1437
5 SASI_Hs01_00172077 predicted 1045
6 SASI_Hs01_00172078 predicted 432
7 SASI_Hs01_00172079 predicted 1665
8 SASI_Hs02_00366578 predicted 752
9 SASI_Hs01_00172080 predicted 1225
10 SASI_Hs01_00172081 predicted 1815
11 SASI_Hs01_00172076 predicted 1425
12 SASI_Hs01_00172082 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297493 predicted 1110
2 SASI_Rn02_00297494 predicted 1328
3 SASI_Rn02_00297495 predicted 1287
4 SASI_Rn02_00297496 predicted 1082
5 SASI_Rn02_00297497 predicted 346
6 SASI_Rn02_00297498 predicted 692
7 SASI_Rn02_00297499 predicted 936
8 SASI_Rn02_00297500 predicted 460
9 SASI_Rn02_00297501 predicted 256
10 SASI_Rn02_00297502 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392912 predicted 1165
2 SASI_Rn02_00392913 predicted 1129
3 SASI_Rn02_00392914 predicted 1340
4 SASI_Rn02_00392915 predicted 1156
5 SASI_Rn02_00392916 predicted 950
6 SASI_Rn02_00392917 predicted 856
7 SASI_Rn02_00392918 predicted 1030
8 SASI_Rn02_00392919 predicted 1129
9 SASI_Rn02_00392920 predicted 1123
10 SASI_Rn02_00392921 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102975 predicted 1107
2 SASI_Mm02_00286094 predicted 263
3 SASI_Mm01_00102978 predicted 371
4 SASI_Mm02_00286095 predicted 1483
5 SASI_Mm01_00102980 predicted 1803
6 SASI_Mm01_00102981 predicted 1132
7 SASI_Mm02_00286096 predicted 334
8 SASI_Mm01_00102982 predicted 1856
9 SASI_Mm02_00286097 predicted 959
10 SASI_Mm02_00286098 predicted 932
11 SASI_Mm01_00102976 predicted 1115
12 SASI_Mm01_00102977 predicted 1724
13 SASI_Mm01_00102979 predicted 1752
14 SASI_Mm01_00102983 predicted 1110
15 SASI_Mm01_00102984 predicted 1316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152683
VALIDATED
CCDC111 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 111
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-646s21c1
Sequence:CCGGAGGAGATGGACAACGTATTTACTCGAGTAAATACGTTGTCCATCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-1978s21c1
Sequence:CCGGTGGCATTGATGATGCTTATTTCTCGAGAAATAAGCATCATCAATGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-859s21c1
Sequence:CCGGTCAAGAGTTATACGGTGTTAACTCGAGTTAACACCGTATAACTCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-548s21c1
Sequence:CCGGCCCTCCATCTGGAGACTATTTCTCGAGAAATAGTCTCCAGATGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-1266s21c1
Sequence:CCGGTTGTAGATCTCGGAGTTTATACTCGAGTATAAACTCCGAGATCTACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-1703s21c1
Sequence:CCGGAGAGCCCATAAGAGTAATAATCTCGAGATTATTACTCTTATGGGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152683.1-279s1c1
Sequence:CCGGGAAACCGTTGTCCTCAGTGTACTCGAGTACACTGAGGACAACGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152683.1-1219s1c1
Sequence:CCGGGTCAGGTTCTCAGATACTTTACTCGAGTAAAGTATCTGAGAACCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152683.1-735s1c1
Sequence:CCGGGCTCCATGATGTGGCATTTAACTCGAGTTAAATGCCACATCATGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152683.1-451s1c1
Sequence:CCGGCTTGTGACAACCTATGCTGAACTCGAGTTCAGCATAGGTTGTCACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152683.1-1926s1c1
Sequence:CCGGCCAGGCTATAATTTGCCTGATCTCGAGATCAGGCAAATTATAGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152683.1-1224s1c1
Sequence:CCGGGTTCTCAGATACTTTACGAATCTCGAGATTCGTAAAGTATCTGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152683
VALIDATED
CCDC111 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 111
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-646s21c1
Sequence:CCGGAGGAGATGGACAACGTATTTACTCGAGTAAATACGTTGTCCATCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-1978s21c1
Sequence:CCGGTGGCATTGATGATGCTTATTTCTCGAGAAATAAGCATCATCAATGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-859s21c1
Sequence:CCGGTCAAGAGTTATACGGTGTTAACTCGAGTTAACACCGTATAACTCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-548s21c1
Sequence:CCGGCCCTCCATCTGGAGACTATTTCTCGAGAAATAGTCTCCAGATGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-1266s21c1
Sequence:CCGGTTGTAGATCTCGGAGTTTATACTCGAGTATAAACTCCGAGATCTACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-1703s21c1
Sequence:CCGGAGAGCCCATAAGAGTAATAATCTCGAGATTATTACTCTTATGGGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152683.1-279s1c1
Sequence:CCGGGAAACCGTTGTCCTCAGTGTACTCGAGTACACTGAGGACAACGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152683.1-1219s1c1
Sequence:CCGGGTCAGGTTCTCAGATACTTTACTCGAGTAAAGTATCTGAGAACCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152683.1-735s1c1
Sequence:CCGGGCTCCATGATGTGGCATTTAACTCGAGTTAAATGCCACATCATGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152683.1-451s1c1
Sequence:CCGGCTTGTGACAACCTATGCTGAACTCGAGTTCAGCATAGGTTGTCACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152683.1-1926s1c1
Sequence:CCGGCCAGGCTATAATTTGCCTGATCTCGAGATCAGGCAAATTATAGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152683.1-1224s1c1
Sequence:CCGGGTTCTCAGATACTTTACGAATCTCGAGATTCGTAAAGTATCTGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152683
VALIDATED
CCDC111 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 111
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-646s21c1
Sequence:CCGGAGGAGATGGACAACGTATTTACTCGAGTAAATACGTTGTCCATCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-1978s21c1
Sequence:CCGGTGGCATTGATGATGCTTATTTCTCGAGAAATAAGCATCATCAATGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-859s21c1
Sequence:CCGGTCAAGAGTTATACGGTGTTAACTCGAGTTAACACCGTATAACTCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-548s21c1
Sequence:CCGGCCCTCCATCTGGAGACTATTTCTCGAGAAATAGTCTCCAGATGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-1266s21c1
Sequence:CCGGTTGTAGATCTCGGAGTTTATACTCGAGTATAAACTCCGAGATCTACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152683.2-1703s21c1
Sequence:CCGGAGAGCCCATAAGAGTAATAATCTCGAGATTATTACTCTTATGGGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152683.1-279s1c1
Sequence:CCGGGAAACCGTTGTCCTCAGTGTACTCGAGTACACTGAGGACAACGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152683.1-1219s1c1
Sequence:CCGGGTCAGGTTCTCAGATACTTTACTCGAGTAAAGTATCTGAGAACCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152683.1-735s1c1
Sequence:CCGGGCTCCATGATGTGGCATTTAACTCGAGTTAAATGCCACATCATGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152683.1-451s1c1
Sequence:CCGGCTTGTGACAACCTATGCTGAACTCGAGTTCAGCATAGGTTGTCACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152683.1-1926s1c1
Sequence:CCGGCCAGGCTATAATTTGCCTGATCTCGAGATCAGGCAAATTATAGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152683.1-1224s1c1
Sequence:CCGGGTTCTCAGATACTTTACGAATCTCGAGATTCGTAAAGTATCTGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001184
CCDC111 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 111
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001184.1-693s21c1
Sequence:CCGGTAACAGGCATGCTGGTAATTTCTCGAGAAATTACCAGCATGCCTGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001184.1-363s21c1
Sequence:CCGGGGGAAATGGACAACGTATTTACTCGAGTAAATACGTTGTCCATTTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001184.1-3404s21c1
Sequence:CCGGCGCACACTATGAACGTGTAAACTCGAGTTTACACGTTCATAGTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001184.1-645s21c1
Sequence:CCGGATTTAGCCGACACCTAATATTCTCGAGAATATTAGGTGTCGGCTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001184.1-1308s21c1
Sequence:CCGGCCCGGAAGAATTACTGGTTTACTCGAGTAAACCAGTAATTCTTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001184
CCDC111 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 111
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001184.1-693s21c1
Sequence:CCGGTAACAGGCATGCTGGTAATTTCTCGAGAAATTACCAGCATGCCTGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001184.1-363s21c1
Sequence:CCGGGGGAAATGGACAACGTATTTACTCGAGTAAATACGTTGTCCATTTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001184.1-3404s21c1
Sequence:CCGGCGCACACTATGAACGTGTAAACTCGAGTTTACACGTTCATAGTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001184.1-645s21c1
Sequence:CCGGATTTAGCCGACACCTAATATTCTCGAGAATATTAGGTGTCGGCTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001184.1-1308s21c1
Sequence:CCGGCCCGGAAGAATTACTGGTTTACTCGAGTAAACCAGTAATTCTTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001184
CCDC111 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 111
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001184.1-693s21c1
Sequence:CCGGTAACAGGCATGCTGGTAATTTCTCGAGAAATTACCAGCATGCCTGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001184.1-363s21c1
Sequence:CCGGGGGAAATGGACAACGTATTTACTCGAGTAAATACGTTGTCCATTTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001184.1-3404s21c1
Sequence:CCGGCGCACACTATGAACGTGTAAACTCGAGTTTACACGTTCATAGTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001184.1-645s21c1
Sequence:CCGGATTTAGCCGACACCTAATATTCTCGAGAATATTAGGTGTCGGCTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001184.1-1308s21c1
Sequence:CCGGCCCGGAAGAATTACTGGTTTACTCGAGTAAACCAGTAATTCTTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)