EMAIL THIS PAGE TO A FRIEND

CCDC112

coiled-coil domain containing 112

103 Gene Product Result for
Synonyms: MBC1
UniProtKB ID: Q8NEF3, Q6A334
Gene ID:
Mouse(240261) coiled-coil domain containing 112
Rat(498858) coiled-coil domain containing 112
chicken(770644) coiled-coil domain containing 112
cow(509840) coiled-coil domain containing 112
Horse(100073169) coiled-coil domain containing 112
domestic cat(101100176) coiled-coil domain containing 112
dog(474638) coiled-coil domain containing 112
sheep(101123303) coiled-coil domain containing 112
domestic guinea pig(100718874) coiled-coil domain containing 112
naked mole-rat(101709778) coiled-coil domain containing 112
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152549 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001160399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001160399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001160399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040440 Rosetta Predictions human pricing
NM_152549 Rosetta Predictions human pricing
NM_001109124 Rosetta Predictions rat pricing
XM_140320 Rosetta Predictions mouse pricing
XM_911119 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308971 predicted 1879
2 SASI_Hs02_00308972 predicted 1945
3 SASI_Hs01_00077988 predicted 893
4 SASI_Hs01_00077991 predicted 866
5 SASI_Hs01_00077992 predicted 785
6 SASI_Hs01_00077993 predicted 855
7 SASI_Hs02_00308973 predicted 1977
8 SASI_Hs02_00308974 predicted 1977
9 SASI_Hs01_00077996 predicted 874
10 SASI_Hs02_00308975 predicted 2098
11 SASI_Hs01_00077989 predicted 939
12 SASI_Hs01_00077990 predicted 971
13 SASI_Hs01_00077994 predicted 715
14 SASI_Hs01_00077995 predicted 836
15 SASI_Hs01_00077997 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158324 predicted 938
2 SASI_Hs01_00158326 predicted 1025
3 SASI_Hs01_00158327 predicted 911
4 SASI_Hs01_00158328 predicted 830
5 SASI_Hs02_00366354 predicted 901
6 SASI_Hs01_00158329 predicted 858
7 SASI_Hs02_00366355 predicted 1951
8 SASI_Hs01_00158330 predicted 784
9 SASI_Hs01_00158332 predicted 923
10 SASI_Hs02_00366356 predicted 1910
11 SASI_Hs01_00158325 predicted 1851
12 SASI_Hs01_00158331 predicted 1843
13 SASI_Hs01_00158333 predicted 1809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245360 predicted 600
2 SASI_Rn02_00245361 predicted 460
3 SASI_Rn02_00245362 predicted 1719
4 SASI_Rn02_00245363 predicted 1678
5 SASI_Rn02_00245364 predicted 593
6 SASI_Rn02_00245365 predicted 727
7 SASI_Rn02_00245366 predicted 525
8 SASI_Rn02_00245367 predicted 1733
9 SASI_Rn02_00245368 predicted 1684
10 SASI_Rn02_00245369 predicted 1674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204043 predicted 476
2 SASI_Mm01_00204044 predicted 1730
3 SASI_Mm02_00424949 predicted 1671
4 SASI_Mm01_00204047 predicted 723
5 SASI_Mm01_00204050 predicted 742
6 SASI_Mm02_00424950 predicted 1692
7 SASI_Mm01_00204051 predicted 1731
8 SASI_Mm01_00204052 predicted 396
9 SASI_Mm02_00424951 predicted 1657
10 SASI_Mm02_00424952 predicted 1664
11 SASI_Mm01_00204045 predicted 803
12 SASI_Mm01_00204046 predicted 737
13 SASI_Mm01_00204048 predicted 910
14 SASI_Mm01_00204049 predicted 1930
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436175 predicted 473
2 SASI_Mm02_00436176 predicted 1727
3 SASI_Mm02_00436177 predicted 1671
4 SASI_Mm02_00436178 predicted 720
5 SASI_Mm02_00436179 predicted 735
6 SASI_Mm02_00436180 predicted 1694
7 SASI_Mm02_00436181 predicted 1732
8 SASI_Mm02_00436182 predicted 392
9 SASI_Mm02_00436183 predicted 1661
10 SASI_Mm02_00436184 predicted 1669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152549
CCDC112 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 112
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152549.1-1776s1c1
Sequence:CCGGCATATCCCACATAGGGCTATTCTCGAGAATAGCCCTATGTGGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152549.1-1889s1c1
Sequence:CCGGGAGAGAGTGACTAACCACATTCTCGAGAATGTGGTTAGTCACTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-705s1c1
Sequence:CCGGCTCAGAGAAATGATGGAAGAACTCGAGTTCTTCCATCATTTCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-846s1c1
Sequence:CCGGGCTTTGGGTAATTCAGAAACACTCGAGTGTTTCTGAATTACCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152549.1-1893s1c1
Sequence:CCGGGAGTGACTAACCACATTCTTTCTCGAGAAAGAATGTGGTTAGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152549.1-532s1c1
Sequence:CCGGGTGACTTCAGAATTGAGCATACTCGAGTATGCTCAATTCTGAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-900s1c1
Sequence:CCGGCCTGTAGACAAAGTAACACCACTCGAGTGGTGTTACTTTGTCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-1458s1c1
Sequence:CCGGCAGCAGAAGAAAGAACAGGAACTCGAGTTCCTGTTCTTTCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-1692s1c1
Sequence:CCGGGATCCCTCTAGGCTTTACAAACTCGAGTTTGTAAAGCCTAGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152549.1-1415s1c1
Sequence:CCGGCCAGCGCCAGTTTAAGTTAAACTCGAGTTTAACTTAAACTGGCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152549
CCDC112 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 112
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152549.1-1776s1c1
Sequence:CCGGCATATCCCACATAGGGCTATTCTCGAGAATAGCCCTATGTGGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152549.1-1889s1c1
Sequence:CCGGGAGAGAGTGACTAACCACATTCTCGAGAATGTGGTTAGTCACTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-705s1c1
Sequence:CCGGCTCAGAGAAATGATGGAAGAACTCGAGTTCTTCCATCATTTCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-846s1c1
Sequence:CCGGGCTTTGGGTAATTCAGAAACACTCGAGTGTTTCTGAATTACCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152549.1-1893s1c1
Sequence:CCGGGAGTGACTAACCACATTCTTTCTCGAGAAAGAATGTGGTTAGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152549.1-532s1c1
Sequence:CCGGGTGACTTCAGAATTGAGCATACTCGAGTATGCTCAATTCTGAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-900s1c1
Sequence:CCGGCCTGTAGACAAAGTAACACCACTCGAGTGGTGTTACTTTGTCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-1458s1c1
Sequence:CCGGCAGCAGAAGAAAGAACAGGAACTCGAGTTCCTGTTCTTTCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-1692s1c1
Sequence:CCGGGATCCCTCTAGGCTTTACAAACTCGAGTTTGTAAAGCCTAGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152549.1-1415s1c1
Sequence:CCGGCCAGCGCCAGTTTAAGTTAAACTCGAGTTTAACTTAAACTGGCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152549
CCDC112 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 112
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152549.1-1776s1c1
Sequence:CCGGCATATCCCACATAGGGCTATTCTCGAGAATAGCCCTATGTGGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152549.1-1889s1c1
Sequence:CCGGGAGAGAGTGACTAACCACATTCTCGAGAATGTGGTTAGTCACTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-705s1c1
Sequence:CCGGCTCAGAGAAATGATGGAAGAACTCGAGTTCTTCCATCATTTCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-846s1c1
Sequence:CCGGGCTTTGGGTAATTCAGAAACACTCGAGTGTTTCTGAATTACCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152549.1-1893s1c1
Sequence:CCGGGAGTGACTAACCACATTCTTTCTCGAGAAAGAATGTGGTTAGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152549.1-532s1c1
Sequence:CCGGGTGACTTCAGAATTGAGCATACTCGAGTATGCTCAATTCTGAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-900s1c1
Sequence:CCGGCCTGTAGACAAAGTAACACCACTCGAGTGGTGTTACTTTGTCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-1458s1c1
Sequence:CCGGCAGCAGAAGAAAGAACAGGAACTCGAGTTCCTGTTCTTTCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152549.1-1692s1c1
Sequence:CCGGGATCCCTCTAGGCTTTACAAACTCGAGTTTGTAAAGCCTAGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152549.1-1415s1c1
Sequence:CCGGCCAGCGCCAGTTTAAGTTAAACTCGAGTTTAACTTAAACTGGCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160399
CCDC112 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 112
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000346710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160399.1-1564s21c1
Sequence:CCGGTAGAGATCCTTCTAGGCTTTACTCGAGTAAAGCCTAGAAGGATCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160399.1-410s21c1
Sequence:CCGGGACTTCAGAACTGAGTATAATCTCGAGATTATACTCAGTTCTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160399.1-1757s21c1
Sequence:CCGGAGACGATTAGCTATGCTATTTCTCGAGAAATAGCATAGCTAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160399.1-505s21c1
Sequence:CCGGCAAGATACATAACAACGTAAACTCGAGTTTACGTTGTTATGTATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160399
CCDC112 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 112
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000346710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160399.1-1564s21c1
Sequence:CCGGTAGAGATCCTTCTAGGCTTTACTCGAGTAAAGCCTAGAAGGATCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160399.1-410s21c1
Sequence:CCGGGACTTCAGAACTGAGTATAATCTCGAGATTATACTCAGTTCTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160399.1-1757s21c1
Sequence:CCGGAGACGATTAGCTATGCTATTTCTCGAGAAATAGCATAGCTAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160399.1-505s21c1
Sequence:CCGGCAAGATACATAACAACGTAAACTCGAGTTTACGTTGTTATGTATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160399
CCDC112 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 112
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000346710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160399.1-1564s21c1
Sequence:CCGGTAGAGATCCTTCTAGGCTTTACTCGAGTAAAGCCTAGAAGGATCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160399.1-410s21c1
Sequence:CCGGGACTTCAGAACTGAGTATAATCTCGAGATTATACTCAGTTCTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160399.1-1757s21c1
Sequence:CCGGAGACGATTAGCTATGCTATTTCTCGAGAAATAGCATAGCTAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160399.1-505s21c1
Sequence:CCGGCAAGATACATAACAACGTAAACTCGAGTTTACGTTGTTATGTATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks