EMAIL THIS PAGE TO A FRIEND

CCDC113

coiled-coil domain containing 113

186 Gene Product Result for
UniProtKB ID: Q9H0I3, B2RAQ7, B4DR20, Q9NZX2
Gene ID:
Mouse(244608) coiled-coil domain containing 113
Rat(291847) coiled-coil domain containing 113
naked mole-rat(101717045) coiled-coil domain containing 113
domestic guinea pig(100713386) coiled-coil domain containing 113
sheep(101104419) coiled-coil domain containing 113
Zebrafish(450041) coiled-coil domain containing 113
cow(528348) coiled-coil domain containing 113
domestic cat(101088536) coiled-coil domain containing 113
dog(487255) coiled-coil domain containing 113
chicken(768642) coiled-coil domain containing 113
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014157 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014157 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014157 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000961 MISSION® esiRNA esiRNA targeting human CCDC113 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014157 Rosetta Predictions human pricing
XM_001060951 Rosetta Predictions rat pricing
XM_214631 Rosetta Predictions rat pricing
NM_172914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345147 predicted 438
2 SASI_Hs01_00087818 predicted 485
3 SASI_Hs01_00087819 predicted 1084
4 SASI_Hs01_00087820 predicted 748
5 SASI_Hs01_00087821 predicted 784
6 SASI_Hs01_00087822 predicted 726
7 SASI_Hs01_00087823 predicted 470
8 SASI_Hs01_00087824 predicted 1164
9 SASI_Hs01_00087825 predicted 236
10 SASI_Hs01_00087826 predicted 805
11 SASI_Hs01_00087827 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298242 predicted 377
2 SASI_Rn02_00298243 predicted 830
3 SASI_Rn02_00298244 predicted 734
4 SASI_Rn02_00298245 predicted 560
5 SASI_Rn02_00298246 predicted 689
6 SASI_Rn02_00298247 predicted 670
7 SASI_Rn02_00298248 predicted 927
8 SASI_Rn02_00298249 predicted 983
9 SASI_Rn02_00298250 predicted 854
10 SASI_Rn02_00298251 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375465 predicted 929
2 SASI_Rn02_00375466 predicted 991
3 SASI_Rn02_00375467 predicted 995
4 SASI_Rn02_00375468 predicted 943
5 SASI_Rn02_00375469 predicted 940
6 SASI_Rn02_00375470 predicted 993
7 SASI_Rn02_00375471 predicted 939
8 SASI_Rn02_00375472 predicted 944
9 SASI_Rn02_00375473 predicted 1000
10 SASI_Rn02_00375474 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023208 predicted 245
2 SASI_Mm01_00023209 predicted 964
3 SASI_Mm01_00023210 predicted 420
4 SASI_Mm01_00023211 predicted 248
5 SASI_Mm01_00023212 predicted 474
6 SASI_Mm01_00023213 predicted 908
7 SASI_Mm01_00023214 predicted 1020
8 SASI_Mm01_00023215 predicted 563
9 SASI_Mm01_00023216 predicted 865
10 SASI_Mm02_00344906 predicted 599
11 SASI_Mm01_00023207 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172914
CCDC113 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 113
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-245s21c1
Sequence:CCGGACCACCGAATGACACGGTTGTCTCGAGACAACCGTGTCATTCGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-1101s21c1
Sequence:CCGGGAAGGTGGAGATCGCAGAGATCTCGAGATCTCTGCGATCTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-1168s21c1
Sequence:CCGGGATGAGCAGTTGCAGATAATCCTCGAGGATTATCTGCAACTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-202s21c1
Sequence:CCGGACAGAGATGTTCGAGAAATATCTCGAGATATTTCTCGAACATCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-503s21c1
Sequence:CCGGAGAAAGCAGTGCACGAATTTGCTCGAGCAAATTCGTGCACTGCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172914.1-991s1c1
Sequence:CCGGCGATAAGTTACGGAAGCAGCTCTCGAGAGCTGCTTCCGTAACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172914.1-872s1c1
Sequence:CCGGGCAATGGAGATCTACGTCAATCTCGAGATTGACGTAGATCTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172914.1-1072s1c1
Sequence:CCGGGCTAGAGAAGACCATCAAGATCTCGAGATCTTGATGGTCTTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172914.1-406s1c1
Sequence:CCGGGAGAGATGAAATACGGCACATCTCGAGATGTGCCGTATTTCATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172914
CCDC113 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 113
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-245s21c1
Sequence:CCGGACCACCGAATGACACGGTTGTCTCGAGACAACCGTGTCATTCGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-1101s21c1
Sequence:CCGGGAAGGTGGAGATCGCAGAGATCTCGAGATCTCTGCGATCTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-1168s21c1
Sequence:CCGGGATGAGCAGTTGCAGATAATCCTCGAGGATTATCTGCAACTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-202s21c1
Sequence:CCGGACAGAGATGTTCGAGAAATATCTCGAGATATTTCTCGAACATCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-503s21c1
Sequence:CCGGAGAAAGCAGTGCACGAATTTGCTCGAGCAAATTCGTGCACTGCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172914.1-991s1c1
Sequence:CCGGCGATAAGTTACGGAAGCAGCTCTCGAGAGCTGCTTCCGTAACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172914.1-872s1c1
Sequence:CCGGGCAATGGAGATCTACGTCAATCTCGAGATTGACGTAGATCTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172914.1-1072s1c1
Sequence:CCGGGCTAGAGAAGACCATCAAGATCTCGAGATCTTGATGGTCTTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172914.1-406s1c1
Sequence:CCGGGAGAGATGAAATACGGCACATCTCGAGATGTGCCGTATTTCATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172914
CCDC113 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 113
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-245s21c1
Sequence:CCGGACCACCGAATGACACGGTTGTCTCGAGACAACCGTGTCATTCGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-1101s21c1
Sequence:CCGGGAAGGTGGAGATCGCAGAGATCTCGAGATCTCTGCGATCTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-1168s21c1
Sequence:CCGGGATGAGCAGTTGCAGATAATCCTCGAGGATTATCTGCAACTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-202s21c1
Sequence:CCGGACAGAGATGTTCGAGAAATATCTCGAGATATTTCTCGAACATCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172914.2-503s21c1
Sequence:CCGGAGAAAGCAGTGCACGAATTTGCTCGAGCAAATTCGTGCACTGCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172914.1-991s1c1
Sequence:CCGGCGATAAGTTACGGAAGCAGCTCTCGAGAGCTGCTTCCGTAACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172914.1-872s1c1
Sequence:CCGGGCAATGGAGATCTACGTCAATCTCGAGATTGACGTAGATCTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172914.1-1072s1c1
Sequence:CCGGGCTAGAGAAGACCATCAAGATCTCGAGATCTTGATGGTCTTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172914.1-406s1c1
Sequence:CCGGGAGAGATGAAATACGGCACATCTCGAGATGTGCCGTATTTCATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014157
CCDC113 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 113
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000167876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014157.2-1094s1c1
Sequence:CCGGGATAGCAGAGATGTCCTTAAACTCGAGTTTAAGGACATCTCTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014157.2-855s1c1
Sequence:CCGGGCAATGGAAATATACCTCAATCTCGAGATTGAGGTATATTTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014157.2-185s1c1
Sequence:CCGGGACTGAGATGTTTGAGAAATACTCGAGTATTTCTCAAACATCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014157.2-744s1c1
Sequence:CCGGGCTCAATTTCTTGAGACAATTCTCGAGAATTGTCTCAAGAAATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014157
CCDC113 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 113
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000167876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014157.2-1094s1c1
Sequence:CCGGGATAGCAGAGATGTCCTTAAACTCGAGTTTAAGGACATCTCTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014157.2-855s1c1
Sequence:CCGGGCAATGGAAATATACCTCAATCTCGAGATTGAGGTATATTTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014157.2-185s1c1
Sequence:CCGGGACTGAGATGTTTGAGAAATACTCGAGTATTTCTCAAACATCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014157.2-744s1c1
Sequence:CCGGGCTCAATTTCTTGAGACAATTCTCGAGAATTGTCTCAAGAAATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014157
CCDC113 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 113
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000167876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014157.2-1094s1c1
Sequence:CCGGGATAGCAGAGATGTCCTTAAACTCGAGTTTAAGGACATCTCTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014157.2-855s1c1
Sequence:CCGGGCAATGGAAATATACCTCAATCTCGAGATTGAGGTATATTTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014157.2-185s1c1
Sequence:CCGGGACTGAGATGTTTGAGAAATACTCGAGTATTTCTCAAACATCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014157.2-744s1c1
Sequence:CCGGGCTCAATTTCTTGAGACAATTCTCGAGAATTGTCTCAAGAAATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks