EMAIL THIS PAGE TO A FRIEND

CCDC114

coiled-coil domain containing 114

49 Gene Product Result for
Synonyms: CILD20
UniProtKB ID: Q96M63, Q6ZRL4, Q96M06, Q9UFG8
Gene ID:
Human(93233) Summary: This gene encodes a coiled-coil domain-containing protein that is a component of the outer dynein arm docking complex in cilia cells. Mutations in this gene may cause primary ciliary dyskinesia 20. [provided by RefSeq, May 2013]
Mouse(211535) coiled-coil domain containing 114
Rat(308594) coiled-coil domain containing 114
domestic cat(101094555) coiled-coil domain containing 114
cow(617306) coiled-coil domain containing 114
dog(484409) coiled-coil domain containing 114
sheep(101105683) coiled-coil domain containing 114
domestic guinea pig(100732267) coiled-coil domain containing 114
naked mole-rat(101700396) coiled-coil domain containing 114
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144577 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145861 MISSION® esiRNA esiRNA human CCDC114 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144577 Rosetta Predictions human pricing
NM_001126277 Rosetta Predictions rat pricing
NM_001033243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090389 predicted 1639
2 SASI_Hs01_00090390 predicted 225
3 SASI_Hs01_00090391 predicted 1636
4 SASI_Hs01_00090392 predicted 1454
5 SASI_Hs01_00090393 predicted 591
6 SASI_Hs01_00090394 predicted 506
7 SASI_Hs01_00090396 predicted 1037
8 SASI_Hs01_00090397 predicted 1083
9 SASI_Hs02_00364362 predicted 643
10 SASI_Hs01_00090398 predicted 224
11 SASI_Hs01_00090395 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253143 predicted 909
2 SASI_Rn02_00253144 predicted 1801
3 SASI_Rn02_00253145 predicted 1493
4 SASI_Rn02_00253146 predicted 1498
5 SASI_Rn02_00253147 predicted 1077
6 SASI_Rn02_00253148 predicted 1401
7 SASI_Rn02_00253149 predicted 1216
8 SASI_Rn02_00253150 predicted 1045
9 SASI_Rn02_00253151 predicted 809
10 SASI_Rn02_00253152 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184049 predicted 1379
2 SASI_Mm01_00184050 predicted 325
3 SASI_Mm01_00184051 predicted 318
4 SASI_Mm01_00184052 predicted 696
5 SASI_Mm01_00184053 predicted 1516
6 SASI_Mm01_00184054 predicted 495
7 SASI_Mm01_00184055 predicted 1763
8 SASI_Mm01_00184056 predicted 796
9 SASI_Mm01_00184057 predicted 316
10 SASI_Mm01_00184058 predicted 835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144577
CCDC114 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 114
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144577.1-266s1c1
Sequence:CCGGGCGCAACTTTGCTGAGTTCAACTCGAGTTGAACTCAGCAAAGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-242s1c1
Sequence:CCGGGCAGAAGTATCTGGAGATCGACTCGAGTCGATCTCCAGATACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144577.1-276s1c1
Sequence:CCGGGCTGAGTTCAACTTCATCAACCTCGAGGTTGATGAAGTTGAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-284s1c1
Sequence:CCGGCAACTTCATCAACGAGCAGAACTCGAGTTCTGCTCGTTGATGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-323s1c1
Sequence:CCGGGCAGGAAGAGATCAAGGAGATCTCGAGATCTCCTTGATCTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-53s1c1
Sequence:CCGGCCACTTCCTCAAGCTCAAGAACTCGAGTTCTTGAGCTTGAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144577.1-59s1c1
Sequence:CCGGCCTCAAGCTCAAGAACAACGACTCGAGTCGTTGTTCTTGAGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-191s1c1
Sequence:CCGGCCTGAATAAACTGTCCCAGCTCTCGAGAGCTGGGACAGTTTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144577
CCDC114 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 114
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144577.1-266s1c1
Sequence:CCGGGCGCAACTTTGCTGAGTTCAACTCGAGTTGAACTCAGCAAAGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-242s1c1
Sequence:CCGGGCAGAAGTATCTGGAGATCGACTCGAGTCGATCTCCAGATACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144577.1-276s1c1
Sequence:CCGGGCTGAGTTCAACTTCATCAACCTCGAGGTTGATGAAGTTGAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-284s1c1
Sequence:CCGGCAACTTCATCAACGAGCAGAACTCGAGTTCTGCTCGTTGATGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-323s1c1
Sequence:CCGGGCAGGAAGAGATCAAGGAGATCTCGAGATCTCCTTGATCTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-53s1c1
Sequence:CCGGCCACTTCCTCAAGCTCAAGAACTCGAGTTCTTGAGCTTGAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144577.1-59s1c1
Sequence:CCGGCCTCAAGCTCAAGAACAACGACTCGAGTCGTTGTTCTTGAGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-191s1c1
Sequence:CCGGCCTGAATAAACTGTCCCAGCTCTCGAGAGCTGGGACAGTTTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144577
CCDC114 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 114
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144577.1-266s1c1
Sequence:CCGGGCGCAACTTTGCTGAGTTCAACTCGAGTTGAACTCAGCAAAGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-242s1c1
Sequence:CCGGGCAGAAGTATCTGGAGATCGACTCGAGTCGATCTCCAGATACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144577.1-276s1c1
Sequence:CCGGGCTGAGTTCAACTTCATCAACCTCGAGGTTGATGAAGTTGAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-284s1c1
Sequence:CCGGCAACTTCATCAACGAGCAGAACTCGAGTTCTGCTCGTTGATGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-323s1c1
Sequence:CCGGGCAGGAAGAGATCAAGGAGATCTCGAGATCTCCTTGATCTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-53s1c1
Sequence:CCGGCCACTTCCTCAAGCTCAAGAACTCGAGTTCTTGAGCTTGAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144577.1-59s1c1
Sequence:CCGGCCTCAAGCTCAAGAACAACGACTCGAGTCGTTGTTCTTGAGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144577.1-191s1c1
Sequence:CCGGCCTGAATAAACTGTCCCAGCTCTCGAGAGCTGGGACAGTTTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033243
CCDC114 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 114
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033243.2-1081s21c1
Sequence:CCGGATGAGCAGAACTCCGAGATACCTCGAGGTATCTCGGAGTTCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033243.2-259s21c1
Sequence:CCGGCCAAGCTCCAGACGCAGATTACTCGAGTAATCTGCGTCTGGAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033243.2-799s21c1
Sequence:CCGGAGATCTTGCTGCGACAGATATCTCGAGATATCTGTCGCAGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033243.2-949s21c1
Sequence:CCGGAGAAGCTAGTGCTGCGTTATGCTCGAGCATAACGCAGCACTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033243.2-2202s21c1
Sequence:CCGGCCCTAGAGACTCCTTTCTAATCTCGAGATTAGAAAGGAGTCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033243
CCDC114 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 114
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033243.2-1081s21c1
Sequence:CCGGATGAGCAGAACTCCGAGATACCTCGAGGTATCTCGGAGTTCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033243.2-259s21c1
Sequence:CCGGCCAAGCTCCAGACGCAGATTACTCGAGTAATCTGCGTCTGGAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033243.2-799s21c1
Sequence:CCGGAGATCTTGCTGCGACAGATATCTCGAGATATCTGTCGCAGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033243.2-949s21c1
Sequence:CCGGAGAAGCTAGTGCTGCGTTATGCTCGAGCATAACGCAGCACTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033243.2-2202s21c1
Sequence:CCGGCCCTAGAGACTCCTTTCTAATCTCGAGATTAGAAAGGAGTCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033243
CCDC114 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 114
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033243.2-1081s21c1
Sequence:CCGGATGAGCAGAACTCCGAGATACCTCGAGGTATCTCGGAGTTCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033243.2-259s21c1
Sequence:CCGGCCAAGCTCCAGACGCAGATTACTCGAGTAATCTGCGTCTGGAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033243.2-799s21c1
Sequence:CCGGAGATCTTGCTGCGACAGATATCTCGAGATATCTGTCGCAGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033243.2-949s21c1
Sequence:CCGGAGAAGCTAGTGCTGCGTTATGCTCGAGCATAACGCAGCACTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033243.2-2202s21c1
Sequence:CCGGCCCTAGAGACTCCTTTCTAATCTCGAGATTAGAAAGGAGTCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks