EMAIL THIS PAGE TO A FRIEND

CCDC115

coiled-coil domain containing 115

109 Gene Product Result for
Synonyms: ccp1
UniProtKB ID: Q96NT0, Q9BR88
Gene ID:
Mouse(69668) coiled-coil domain containing 115
Rat(363213) coiled-coil domain containing 115
naked mole-rat(101706158) coiled-coil domain containing 115
domestic guinea pig(100730307) coiled-coil domain containing 115
sheep(101103950) coiled-coil domain containing 115
cow(513406) coiled-coil domain containing 115
domestic cat(101080349) coiled-coil domain containing 115
dog(606806) coiled-coil domain containing 115
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027159 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027159 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027159 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032357 Rosetta Predictions human pricing
NM_001108793 Rosetta Predictions rat pricing
XM_343551 Rosetta Predictions rat pricing
NM_027159 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037829 predicted 950
2 SASI_Hs01_00037830 predicted 591
3 SASI_Hs01_00037831 predicted 783
4 SASI_Hs02_00359745 predicted 821
5 SASI_Hs01_00037833 predicted 610
6 SASI_Hs01_00037834 predicted 1003
7 SASI_Hs01_00037835 predicted 887
8 SASI_Hs01_00037836 predicted 921
9 SASI_Hs01_00037837 predicted 227
10 SASI_Hs01_00037838 predicted 952
11 SASI_Hs01_00037832 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242125 predicted 778
2 SASI_Rn02_00242126 predicted 678
3 SASI_Rn02_00242127 predicted 776
4 SASI_Rn02_00242128 predicted 809
5 SASI_Rn02_00242129 predicted 684
6 SASI_Rn02_00242130 predicted 521
7 SASI_Rn02_00242131 predicted 827
8 SASI_Rn02_00242132 predicted 766
9 SASI_Rn02_00242133 predicted 480
10 SASI_Rn02_00242134 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173137 predicted 639
2 SASI_Rn01_00173138 predicted 777
3 SASI_Rn01_00173139 predicted 868
4 SASI_Rn01_00173140 predicted 371
5 SASI_Rn01_00173141 predicted 927
6 SASI_Rn01_00173142 predicted 738
7 SASI_Rn01_00173143 predicted 411
8 SASI_Rn01_00173144 predicted 920
9 SASI_Rn01_00173145 predicted 428
10 SASI_Rn01_00173146 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026095 predicted 758
2 SASI_Mm01_00026096 predicted 913
3 SASI_Mm01_00026097 predicted 664
4 SASI_Mm01_00026098 predicted 468
5 SASI_Mm01_00026099 predicted 789
6 SASI_Mm01_00026100 predicted 1014
7 SASI_Mm01_00026101 predicted 1077
8 SASI_Mm01_00026102 predicted 1101
9 SASI_Mm01_00026103 predicted 657
10 SASI_Mm01_00026104 predicted 421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027159
VALIDATED
CCDC115 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 115
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027159.2-361s21c1
Sequence:CCGGGTTGGACTCCAAGTGCCTACACTCGAGTGTAGGCACTTGGAGTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027159.1-693s21c1
Sequence:CCGGCAAGATCCCTTGAACTGGTTTCTCGAGAAACCAGTTCAAGGGATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027159.1-1373s21c1
Sequence:CCGGGCAGGAAATATTACTTCTGTTCTCGAGAACAGAAGTAATATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027159.2-1022s21c1
Sequence:CCGGCGAGGCATGAAGTTGAGTTATCTCGAGATAACTCAACTTCATGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027159.1-769s21c1
Sequence:CCGGTACAGCTGGCTGCAGATATAGCTCGAGCTATATCTGCAGCCAGCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198732    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027159.1-1503s1c1
Sequence:CCGGCCTGGAAACTGTGTCTTGCTTCTCGAGAAGCAAGACACAGTTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-693s1c1
Sequence:CCGGCAAGATCCCTTGAACTGGTTTCTCGAGAAACCAGTTCAAGGGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-1373s1c1
Sequence:CCGGGCAGGAAATATTACTTCTGTTCTCGAGAACAGAAGTAATATTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-1023s1c1
Sequence:CCGGCGAGGCATGAAGTTGAGTTATCTCGAGATAACTCAACTTCATGCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-669s1c1
Sequence:CCGGGAGTTAGGATCTGCTGTAGTTCTCGAGAACTACAGCAGATCCTAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-665s1c1
Sequence:CCGGCAAAGAGTTAGGATCTGCTGTCTCGAGACAGCAGATCCTAACTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027159
VALIDATED
CCDC115 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 115
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027159.2-361s21c1
Sequence:CCGGGTTGGACTCCAAGTGCCTACACTCGAGTGTAGGCACTTGGAGTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027159.1-693s21c1
Sequence:CCGGCAAGATCCCTTGAACTGGTTTCTCGAGAAACCAGTTCAAGGGATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027159.1-1373s21c1
Sequence:CCGGGCAGGAAATATTACTTCTGTTCTCGAGAACAGAAGTAATATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027159.2-1022s21c1
Sequence:CCGGCGAGGCATGAAGTTGAGTTATCTCGAGATAACTCAACTTCATGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027159.1-769s21c1
Sequence:CCGGTACAGCTGGCTGCAGATATAGCTCGAGCTATATCTGCAGCCAGCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198732    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027159.1-1503s1c1
Sequence:CCGGCCTGGAAACTGTGTCTTGCTTCTCGAGAAGCAAGACACAGTTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-693s1c1
Sequence:CCGGCAAGATCCCTTGAACTGGTTTCTCGAGAAACCAGTTCAAGGGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-1373s1c1
Sequence:CCGGGCAGGAAATATTACTTCTGTTCTCGAGAACAGAAGTAATATTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-1023s1c1
Sequence:CCGGCGAGGCATGAAGTTGAGTTATCTCGAGATAACTCAACTTCATGCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-669s1c1
Sequence:CCGGGAGTTAGGATCTGCTGTAGTTCTCGAGAACTACAGCAGATCCTAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-665s1c1
Sequence:CCGGCAAAGAGTTAGGATCTGCTGTCTCGAGACAGCAGATCCTAACTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027159
VALIDATED
CCDC115 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 115
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027159.2-361s21c1
Sequence:CCGGGTTGGACTCCAAGTGCCTACACTCGAGTGTAGGCACTTGGAGTCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027159.1-693s21c1
Sequence:CCGGCAAGATCCCTTGAACTGGTTTCTCGAGAAACCAGTTCAAGGGATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027159.1-1373s21c1
Sequence:CCGGGCAGGAAATATTACTTCTGTTCTCGAGAACAGAAGTAATATTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027159.2-1022s21c1
Sequence:CCGGCGAGGCATGAAGTTGAGTTATCTCGAGATAACTCAACTTCATGCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027159.1-769s21c1
Sequence:CCGGTACAGCTGGCTGCAGATATAGCTCGAGCTATATCTGCAGCCAGCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198732    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027159.1-1503s1c1
Sequence:CCGGCCTGGAAACTGTGTCTTGCTTCTCGAGAAGCAAGACACAGTTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-693s1c1
Sequence:CCGGCAAGATCCCTTGAACTGGTTTCTCGAGAAACCAGTTCAAGGGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-1373s1c1
Sequence:CCGGGCAGGAAATATTACTTCTGTTCTCGAGAACAGAAGTAATATTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-1023s1c1
Sequence:CCGGCGAGGCATGAAGTTGAGTTATCTCGAGATAACTCAACTTCATGCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-669s1c1
Sequence:CCGGGAGTTAGGATCTGCTGTAGTTCTCGAGAACTACAGCAGATCCTAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027159.1-665s1c1
Sequence:CCGGCAAAGAGTTAGGATCTGCTGTCTCGAGACAGCAGATCCTAACTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032357
CCDC115 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 115
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-728s1c1
Sequence:CCGGCCAAGAGAAACTCAAGCAGCTCTCGAGAGCTGCTTGAGTTTCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032357.2-894s1c1
Sequence:CCGGCCTGCTCTGCATGTTTCCATTCTCGAGAATGGAAACATGCAGAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-459s1c1
Sequence:CCGGCAGAAGTTCAAGGTGGTGAGACTCGAGTCTCACCACCTTGAACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032357.2-993s1c1
Sequence:CCGGCCCATAGGACACACTCACATACTCGAGTATGTGAGTGTGTCCTATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-593s1c1
Sequence:CCGGGAACTGGTTTGGAATCCTAGTCTCGAGACTAGGATTCCAAACCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032357.2-1463s1c1
Sequence:CCGGGCTGTTTATGTTTGGAGGTAACTCGAGTTACCTCCAAACATAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161708    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032357.2-1132s1c1
Sequence:CCGGGCTTAGTACATCCTCCAAATTCTCGAGAATTTGGAGGATGTACTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-599s1c1
Sequence:CCGGGTTTGGAATCCTAGTTCCTCACTCGAGTGAGGAACTAGGATTCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-609s1c1
Sequence:CCGGCTAGTTCCTCACAGTCTACGTCTCGAGACGTAGACTGTGAGGAACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-604s1c1
Sequence:CCGGGAATCCTAGTTCCTCACAGTCCTCGAGGACTGTGAGGAACTAGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032357
CCDC115 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 115
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-728s1c1
Sequence:CCGGCCAAGAGAAACTCAAGCAGCTCTCGAGAGCTGCTTGAGTTTCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032357.2-894s1c1
Sequence:CCGGCCTGCTCTGCATGTTTCCATTCTCGAGAATGGAAACATGCAGAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-459s1c1
Sequence:CCGGCAGAAGTTCAAGGTGGTGAGACTCGAGTCTCACCACCTTGAACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032357.2-993s1c1
Sequence:CCGGCCCATAGGACACACTCACATACTCGAGTATGTGAGTGTGTCCTATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-593s1c1
Sequence:CCGGGAACTGGTTTGGAATCCTAGTCTCGAGACTAGGATTCCAAACCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032357.2-1463s1c1
Sequence:CCGGGCTGTTTATGTTTGGAGGTAACTCGAGTTACCTCCAAACATAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161708    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032357.2-1132s1c1
Sequence:CCGGGCTTAGTACATCCTCCAAATTCTCGAGAATTTGGAGGATGTACTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-599s1c1
Sequence:CCGGGTTTGGAATCCTAGTTCCTCACTCGAGTGAGGAACTAGGATTCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-609s1c1
Sequence:CCGGCTAGTTCCTCACAGTCTACGTCTCGAGACGTAGACTGTGAGGAACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-604s1c1
Sequence:CCGGGAATCCTAGTTCCTCACAGTCCTCGAGGACTGTGAGGAACTAGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032357
CCDC115 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 115
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-728s1c1
Sequence:CCGGCCAAGAGAAACTCAAGCAGCTCTCGAGAGCTGCTTGAGTTTCTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032357.2-894s1c1
Sequence:CCGGCCTGCTCTGCATGTTTCCATTCTCGAGAATGGAAACATGCAGAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-459s1c1
Sequence:CCGGCAGAAGTTCAAGGTGGTGAGACTCGAGTCTCACCACCTTGAACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032357.2-993s1c1
Sequence:CCGGCCCATAGGACACACTCACATACTCGAGTATGTGAGTGTGTCCTATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-593s1c1
Sequence:CCGGGAACTGGTTTGGAATCCTAGTCTCGAGACTAGGATTCCAAACCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032357.2-1463s1c1
Sequence:CCGGGCTGTTTATGTTTGGAGGTAACTCGAGTTACCTCCAAACATAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161708    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032357.2-1132s1c1
Sequence:CCGGGCTTAGTACATCCTCCAAATTCTCGAGAATTTGGAGGATGTACTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-599s1c1
Sequence:CCGGGTTTGGAATCCTAGTTCCTCACTCGAGTGAGGAACTAGGATTCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-609s1c1
Sequence:CCGGCTAGTTCCTCACAGTCTACGTCTCGAGACGTAGACTGTGAGGAACTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032357.2-604s1c1
Sequence:CCGGGAATCCTAGTTCCTCACAGTCCTCGAGGACTGTGAGGAACTAGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)