EMAIL THIS PAGE TO A FRIEND

CCDC116

coiled-coil domain containing 116

41 Gene Product Result for
UniProtKB ID: Q8IYX3, Q8N9Y9
Gene ID:
Mouse(76872) coiled-coil domain containing 116
Rat(287936) coiled-coil domain containing 116
dog(486447) coiled-coil domain containing 116
domestic cat(101091564) coiled-coil domain containing 116
cow(618136) coiled-coil domain containing 116
sheep(101116259) coiled-coil domain containing 116
domestic guinea pig(100714617) coiled-coil domain containing 116
naked mole-rat(101703799) coiled-coil domain containing 116
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152612 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044911 MISSION® esiRNA esiRNA human CCDC116 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152612 Rosetta Predictions human pricing
NM_001024740 Rosetta Predictions rat pricing
NM_029779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063938 predicted 1545
2 SASI_Hs01_00063939 predicted 1764
3 SASI_Hs01_00063940 predicted 1844
4 SASI_Hs01_00063941 predicted 1757
5 SASI_Hs01_00063942 predicted 1834
6 SASI_Hs01_00063943 predicted 1343
7 SASI_Hs01_00063945 predicted 488
8 SASI_Hs01_00063946 predicted 1353
9 SASI_Hs01_00063947 predicted 756
10 SASI_Hs02_00366464 predicted 1629
11 SASI_Hs01_00063944 predicted 1778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049446 predicted 196
2 SASI_Rn01_00049447 predicted 450
3 SASI_Rn01_00049448 predicted 1307
4 SASI_Rn01_00049449 predicted 789
5 SASI_Rn01_00049450 predicted 999
6 SASI_Rn01_00049451 predicted 1182
7 SASI_Rn01_00049452 predicted 1491
8 SASI_Rn01_00049453 predicted 1027
9 SASI_Rn01_00049454 predicted 1457
10 SASI_Rn01_00049455 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122915 predicted 600
2 SASI_Mm01_00122917 predicted 1774
3 SASI_Mm01_00122918 predicted 728
4 SASI_Mm01_00122919 predicted 1764
5 SASI_Mm01_00122920 predicted 481
6 SASI_Mm01_00122921 predicted 1024
7 SASI_Mm01_00122922 predicted 1309
8 SASI_Mm02_00335925 predicted 1499
9 SASI_Mm01_00122923 predicted 1362
10 SASI_Mm01_00122924 predicted 1638
11 SASI_Mm01_00122916 predicted 1472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029779
CCDC116 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 116
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029779.1-1796s1c1
Sequence:CCGGCATATCTCTCAGCCCTGTCATCTCGAGATGACAGGGCTGAGAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029779.1-2207s1c1
Sequence:CCGGCCAGATGTTGTCAAAGATTAACTCGAGTTAATCTTTGACAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029779.1-891s1c1
Sequence:CCGGGCCCAAACAATTACCCATCTTCTCGAGAAGATGGGTAATTGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029779.1-1600s1c1
Sequence:CCGGCCCTAAGACATCTCACAGAAACTCGAGTTTCTGTGAGATGTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029779.1-1314s1c1
Sequence:CCGGCCTTCAACCTGCCTACCTATTCTCGAGAATAGGTAGGCAGGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029779.1-585s1c1
Sequence:CCGGGTGTACCACACCTACCATCAACTCGAGTTGATGGTAGGTGTGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029779
CCDC116 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 116
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029779.1-1796s1c1
Sequence:CCGGCATATCTCTCAGCCCTGTCATCTCGAGATGACAGGGCTGAGAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029779.1-2207s1c1
Sequence:CCGGCCAGATGTTGTCAAAGATTAACTCGAGTTAATCTTTGACAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029779.1-891s1c1
Sequence:CCGGGCCCAAACAATTACCCATCTTCTCGAGAAGATGGGTAATTGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029779.1-1600s1c1
Sequence:CCGGCCCTAAGACATCTCACAGAAACTCGAGTTTCTGTGAGATGTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029779.1-1314s1c1
Sequence:CCGGCCTTCAACCTGCCTACCTATTCTCGAGAATAGGTAGGCAGGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029779.1-585s1c1
Sequence:CCGGGTGTACCACACCTACCATCAACTCGAGTTGATGGTAGGTGTGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029779
CCDC116 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 116
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029779.1-1796s1c1
Sequence:CCGGCATATCTCTCAGCCCTGTCATCTCGAGATGACAGGGCTGAGAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029779.1-2207s1c1
Sequence:CCGGCCAGATGTTGTCAAAGATTAACTCGAGTTAATCTTTGACAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029779.1-891s1c1
Sequence:CCGGGCCCAAACAATTACCCATCTTCTCGAGAAGATGGGTAATTGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029779.1-1600s1c1
Sequence:CCGGCCCTAAGACATCTCACAGAAACTCGAGTTTCTGTGAGATGTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029779.1-1314s1c1
Sequence:CCGGCCTTCAACCTGCCTACCTATTCTCGAGAATAGGTAGGCAGGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029779.1-585s1c1
Sequence:CCGGGTGTACCACACCTACCATCAACTCGAGTTGATGGTAGGTGTGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152612
CCDC116 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 116
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152612.2-1887s1c1
Sequence:CCGGGTTCAAGGATGAAGACCAGGACTCGAGTCCTGGTCTTCATCCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-1353s1c1
Sequence:CCGGGAAGTCCAGCATGTCTCACTTCTCGAGAAGTGAGACATGCTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152612.2-1906s1c1
Sequence:CCGGGATGAGGACAAGGATGAGGATCTCGAGATCCTCATCCTTGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-900s1c1
Sequence:CCGGGCGAGAGTTCAATAAGGAGATCTCGAGATCTCCTTATTGAACTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-1849s1c1
Sequence:CCGGCGTGATAAAGCCGAGATTGAACTCGAGTTCAATCTCGGCTTTATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152612.2-1311s1c1
Sequence:CCGGCAGCAGGTTCACGAAGAAGAACTCGAGTTCTTCTTCGTGAACCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-894s1c1
Sequence:CCGGCCGCAAGCGAGAGTTCAATAACTCGAGTTATTGAACTCTCGCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-1591s1c1
Sequence:CCGGCGTAAACTGGAGGAGTCCAAACTCGAGTTTGGACTCCTCCAGTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152612
CCDC116 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 116
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152612.2-1887s1c1
Sequence:CCGGGTTCAAGGATGAAGACCAGGACTCGAGTCCTGGTCTTCATCCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-1353s1c1
Sequence:CCGGGAAGTCCAGCATGTCTCACTTCTCGAGAAGTGAGACATGCTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152612.2-1906s1c1
Sequence:CCGGGATGAGGACAAGGATGAGGATCTCGAGATCCTCATCCTTGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-900s1c1
Sequence:CCGGGCGAGAGTTCAATAAGGAGATCTCGAGATCTCCTTATTGAACTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-1849s1c1
Sequence:CCGGCGTGATAAAGCCGAGATTGAACTCGAGTTCAATCTCGGCTTTATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152612.2-1311s1c1
Sequence:CCGGCAGCAGGTTCACGAAGAAGAACTCGAGTTCTTCTTCGTGAACCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-894s1c1
Sequence:CCGGCCGCAAGCGAGAGTTCAATAACTCGAGTTATTGAACTCTCGCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-1591s1c1
Sequence:CCGGCGTAAACTGGAGGAGTCCAAACTCGAGTTTGGACTCCTCCAGTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152612
CCDC116 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 116
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152612.2-1887s1c1
Sequence:CCGGGTTCAAGGATGAAGACCAGGACTCGAGTCCTGGTCTTCATCCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-1353s1c1
Sequence:CCGGGAAGTCCAGCATGTCTCACTTCTCGAGAAGTGAGACATGCTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152612.2-1906s1c1
Sequence:CCGGGATGAGGACAAGGATGAGGATCTCGAGATCCTCATCCTTGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-900s1c1
Sequence:CCGGGCGAGAGTTCAATAAGGAGATCTCGAGATCTCCTTATTGAACTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-1849s1c1
Sequence:CCGGCGTGATAAAGCCGAGATTGAACTCGAGTTCAATCTCGGCTTTATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152612.2-1311s1c1
Sequence:CCGGCAGCAGGTTCACGAAGAAGAACTCGAGTTCTTCTTCGTGAACCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-894s1c1
Sequence:CCGGCCGCAAGCGAGAGTTCAATAACTCGAGTTATTGAACTCTCGCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152612.2-1591s1c1
Sequence:CCGGCGTAAACTGGAGGAGTCCAAACTCGAGTTTGGACTCCTCCAGTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks