EMAIL THIS PAGE TO A FRIEND

CCDC117

coiled-coil domain containing 117

Synonyms: dJ366L4.1
UniProtKB ID: Q8IWD4, A8K0F1, Q6ICA7, Q8N278
Gene ID:
Mouse(104479) coiled-coil domain containing 117
Rat(498404) coiled-coil domain containing 117
naked mole-rat(101722744) coiled-coil domain containing 117
domestic guinea pig(100720012) coiled-coil domain containing 117
sheep(101106715) coiled-coil domain containing 117
chicken(416917) coiled-coil domain containing 117
dog(611823) coiled-coil domain containing 117
cow(615668) coiled-coil domain containing 117
domestic cat(101091905) coiled-coil domain containing 117
219 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173510 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134033 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134033 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134033 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173510 Rosetta Predictions human pricing
NM_001017502 Rosetta Predictions rat pricing
NM_134033 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108094 predicted 458
2 SASI_Hs01_00108095 predicted 1038
3 SASI_Hs01_00108096 predicted 968
4 SASI_Hs01_00108097 predicted 563
5 SASI_Hs01_00108098 predicted 500
6 SASI_Hs01_00108099 predicted 720
7 SASI_Hs01_00108100 predicted 413
8 SASI_Hs01_00108101 predicted 909
9 SASI_Hs01_00108102 predicted 411
10 SASI_Hs02_00368282 predicted 953
11 SASI_Hs01_00108093 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114109 predicted 759
2 SASI_Rn01_00114110 predicted 387
3 SASI_Rn01_00114111 predicted 454
4 SASI_Rn01_00114112 predicted 528
5 SASI_Rn01_00114113 predicted 389
6 SASI_Rn01_00114114 predicted 325
7 SASI_Rn02_00202325 predicted 436
8 SASI_Rn01_00114115 predicted 262
9 SASI_Rn01_00114116 predicted 609
10 SASI_Rn01_00114117 predicted 506
11 SASI_Rn01_00114118 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167821 predicted 931
2 SASI_Mm01_00167822 predicted 822
3 SASI_Mm01_00167823 predicted 744
4 SASI_Mm01_00167824 predicted 602
5 SASI_Mm02_00339197 predicted 743
6 SASI_Mm01_00167825 predicted 665
7 SASI_Mm01_00167826 predicted 520
8 SASI_Mm01_00167827 predicted 333
9 SASI_Mm01_00167828 predicted 606
10 SASI_Mm01_00167829 predicted 773
11 SASI_Mm01_00167830 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173510
VALIDATED
CCDC117 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 117
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173510.1-783s1c1
Sequence:CCGGCTTTCTGATAAGCCAAAGCCACTCGAGTGGCTTTGGCTTATCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173510.1-461s1c1
Sequence:CCGGGCATGGAGTAAATCCCAGTGTCTCGAGACACTGGGATTTACTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173510.1-933s1c1
Sequence:CCGGGAGACAGCTACTAGCACAGAACTCGAGTTCTGTGCTAGTAGCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173510.1-837s1c1
Sequence:CCGGCAAGCTAAGCATGTAGCTGCTCTCGAGAGCAGCTACATGCTTAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173510.1-869s1c1
Sequence:CCGGCCCTCAGAGAACTGAACTGTTCTCGAGAACAGTTCAGTTCTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173510.1-649s1c1
Sequence:CCGGCCAGTCTTGTCCTTTCTGATACTCGAGTATCAGAAAGGACAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173510.1-2188s1c1
Sequence:CCGGGCTTAGACTATTGTGCAGTAACTCGAGTTACTGCACAATAGTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173510.1-315s1c1
Sequence:CCGGCGTGTTTCTGTTCACTGTAAACTCGAGTTTACAGTGAACAGAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173510.1-1642s1c1
Sequence:CCGGCGTAATTGATAAGCCCAGTTACTCGAGTAACTGGGCTTATCAATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-660s21c1
Sequence:CCGGGAAGTTGAAGCTGACAGAAATCTCGAGATTTCTGTCAGCTTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173510.2-1444s21c1
Sequence:CCGGTGTTTACAGTGGTGACTATATCTCGAGATATAGTCACCACTGTAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-625s21c1
Sequence:CCGGAGGAGATTGAGGACAGGATAACTCGAGTTATCCTGTCCTCAATCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-723s21c1
Sequence:CCGGACAGGTTTGAAGAGGGAATTTCTCGAGAAATTCCCTCTTCAAACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173510.2-1296s21c1
Sequence:CCGGTAAGGGTGACTTAAATCATATCTCGAGATATGATTTAAGTCACCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-411s21c1
Sequence:CCGGGATGATTGTCCAGTAAGAAAGCTCGAGCTTTCTTACTGGACAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-542s21c1
Sequence:CCGGACCTGGGATATTAGATGTTATCTCGAGATAACATCTAATATCCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-783s21c1
Sequence:CCGGCGTCCTTCCATGGAGCTTGTTCTCGAGAACAAGCTCCATGGAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173510.2-1073s21c1
Sequence:CCGGGAGACTCTTTGCATAGTATAGCTCGAGCTATACTATGCAAAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173510
VALIDATED
CCDC117 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 117
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173510.1-783s1c1
Sequence:CCGGCTTTCTGATAAGCCAAAGCCACTCGAGTGGCTTTGGCTTATCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173510.1-461s1c1
Sequence:CCGGGCATGGAGTAAATCCCAGTGTCTCGAGACACTGGGATTTACTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173510.1-933s1c1
Sequence:CCGGGAGACAGCTACTAGCACAGAACTCGAGTTCTGTGCTAGTAGCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173510.1-837s1c1
Sequence:CCGGCAAGCTAAGCATGTAGCTGCTCTCGAGAGCAGCTACATGCTTAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173510.1-869s1c1
Sequence:CCGGCCCTCAGAGAACTGAACTGTTCTCGAGAACAGTTCAGTTCTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173510.1-649s1c1
Sequence:CCGGCCAGTCTTGTCCTTTCTGATACTCGAGTATCAGAAAGGACAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173510.1-2188s1c1
Sequence:CCGGGCTTAGACTATTGTGCAGTAACTCGAGTTACTGCACAATAGTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173510.1-315s1c1
Sequence:CCGGCGTGTTTCTGTTCACTGTAAACTCGAGTTTACAGTGAACAGAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173510.1-1642s1c1
Sequence:CCGGCGTAATTGATAAGCCCAGTTACTCGAGTAACTGGGCTTATCAATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-660s21c1
Sequence:CCGGGAAGTTGAAGCTGACAGAAATCTCGAGATTTCTGTCAGCTTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173510.2-1444s21c1
Sequence:CCGGTGTTTACAGTGGTGACTATATCTCGAGATATAGTCACCACTGTAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-625s21c1
Sequence:CCGGAGGAGATTGAGGACAGGATAACTCGAGTTATCCTGTCCTCAATCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-723s21c1
Sequence:CCGGACAGGTTTGAAGAGGGAATTTCTCGAGAAATTCCCTCTTCAAACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173510.2-1296s21c1
Sequence:CCGGTAAGGGTGACTTAAATCATATCTCGAGATATGATTTAAGTCACCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-411s21c1
Sequence:CCGGGATGATTGTCCAGTAAGAAAGCTCGAGCTTTCTTACTGGACAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-542s21c1
Sequence:CCGGACCTGGGATATTAGATGTTATCTCGAGATAACATCTAATATCCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-783s21c1
Sequence:CCGGCGTCCTTCCATGGAGCTTGTTCTCGAGAACAAGCTCCATGGAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173510.2-1073s21c1
Sequence:CCGGGAGACTCTTTGCATAGTATAGCTCGAGCTATACTATGCAAAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173510
VALIDATED
CCDC117 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 117
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173510.1-783s1c1
Sequence:CCGGCTTTCTGATAAGCCAAAGCCACTCGAGTGGCTTTGGCTTATCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173510.1-461s1c1
Sequence:CCGGGCATGGAGTAAATCCCAGTGTCTCGAGACACTGGGATTTACTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173510.1-933s1c1
Sequence:CCGGGAGACAGCTACTAGCACAGAACTCGAGTTCTGTGCTAGTAGCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173510.1-837s1c1
Sequence:CCGGCAAGCTAAGCATGTAGCTGCTCTCGAGAGCAGCTACATGCTTAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173510.1-869s1c1
Sequence:CCGGCCCTCAGAGAACTGAACTGTTCTCGAGAACAGTTCAGTTCTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173510.1-649s1c1
Sequence:CCGGCCAGTCTTGTCCTTTCTGATACTCGAGTATCAGAAAGGACAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173510.1-2188s1c1
Sequence:CCGGGCTTAGACTATTGTGCAGTAACTCGAGTTACTGCACAATAGTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173510.1-315s1c1
Sequence:CCGGCGTGTTTCTGTTCACTGTAAACTCGAGTTTACAGTGAACAGAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173510.1-1642s1c1
Sequence:CCGGCGTAATTGATAAGCCCAGTTACTCGAGTAACTGGGCTTATCAATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-660s21c1
Sequence:CCGGGAAGTTGAAGCTGACAGAAATCTCGAGATTTCTGTCAGCTTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173510.2-1444s21c1
Sequence:CCGGTGTTTACAGTGGTGACTATATCTCGAGATATAGTCACCACTGTAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-625s21c1
Sequence:CCGGAGGAGATTGAGGACAGGATAACTCGAGTTATCCTGTCCTCAATCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-723s21c1
Sequence:CCGGACAGGTTTGAAGAGGGAATTTCTCGAGAAATTCCCTCTTCAAACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173510.2-1296s21c1
Sequence:CCGGTAAGGGTGACTTAAATCATATCTCGAGATATGATTTAAGTCACCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-411s21c1
Sequence:CCGGGATGATTGTCCAGTAAGAAAGCTCGAGCTTTCTTACTGGACAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-542s21c1
Sequence:CCGGACCTGGGATATTAGATGTTATCTCGAGATAACATCTAATATCCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173510.2-783s21c1
Sequence:CCGGCGTCCTTCCATGGAGCTTGTTCTCGAGAACAAGCTCCATGGAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173510.2-1073s21c1
Sequence:CCGGGAGACTCTTTGCATAGTATAGCTCGAGCTATACTATGCAAAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134033
VALIDATED
CCDC117 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 117
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134033.1-760s1c1
Sequence:CCGGGCCATCATCTAGCCCTAAGAACTCGAGTTCTTAGGGCTAGATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134033.1-538s1c1
Sequence:CCGGGCAAGAGATTGAGGACAGGATCTCGAGATCCTGTCCTCAATCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134033.1-551s1c1
Sequence:CCGGGACAGGATAATTGACGAAGATCTCGAGATCTTCGTCAATTATCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134033.1-329s1c1
Sequence:CCGGGAGTGTCCAGTAAGAAAGAAACTCGAGTTTCTTTCTTACTGGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134033.1-276s1c1
Sequence:CCGGGACGTGTTTCCATTCACTGTACTCGAGTACAGTGAATGGAAACACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134033.2-738s1c1
Sequence:CCGGGAGGATGATTGAGTCTATGAGCTCGAGCTCATAGACTCAATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-1338s21c1
Sequence:CCGGATCGCCACTGCACCCTAATTGCTCGAGCAATTAGGGTGCAGTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-338s21c1
Sequence:CCGGGACGTGTTTCCATTCACTGTACTCGAGTACAGTGAATGGAAACACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-751s21c1
Sequence:CCGGTCTATGAGCCGTCCTTCTATGCTCGAGCATAGAAGGACGGCTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-432s21c1
Sequence:CCGGCGGTGCAGTTACTGATGAATGCTCGAGCATTCATCAGTAACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-700s21c1
Sequence:CCGGACGGGTTTGAAGAGGGAATTTCTCGAGAAATTCCCTCTTCAAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134033
VALIDATED
CCDC117 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 117
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134033.1-760s1c1
Sequence:CCGGGCCATCATCTAGCCCTAAGAACTCGAGTTCTTAGGGCTAGATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134033.1-538s1c1
Sequence:CCGGGCAAGAGATTGAGGACAGGATCTCGAGATCCTGTCCTCAATCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134033.1-551s1c1
Sequence:CCGGGACAGGATAATTGACGAAGATCTCGAGATCTTCGTCAATTATCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134033.1-329s1c1
Sequence:CCGGGAGTGTCCAGTAAGAAAGAAACTCGAGTTTCTTTCTTACTGGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134033.1-276s1c1
Sequence:CCGGGACGTGTTTCCATTCACTGTACTCGAGTACAGTGAATGGAAACACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134033.2-738s1c1
Sequence:CCGGGAGGATGATTGAGTCTATGAGCTCGAGCTCATAGACTCAATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-1338s21c1
Sequence:CCGGATCGCCACTGCACCCTAATTGCTCGAGCAATTAGGGTGCAGTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-338s21c1
Sequence:CCGGGACGTGTTTCCATTCACTGTACTCGAGTACAGTGAATGGAAACACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-751s21c1
Sequence:CCGGTCTATGAGCCGTCCTTCTATGCTCGAGCATAGAAGGACGGCTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-432s21c1
Sequence:CCGGCGGTGCAGTTACTGATGAATGCTCGAGCATTCATCAGTAACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-700s21c1
Sequence:CCGGACGGGTTTGAAGAGGGAATTTCTCGAGAAATTCCCTCTTCAAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134033
VALIDATED
CCDC117 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 117
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134033.1-760s1c1
Sequence:CCGGGCCATCATCTAGCCCTAAGAACTCGAGTTCTTAGGGCTAGATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134033.1-538s1c1
Sequence:CCGGGCAAGAGATTGAGGACAGGATCTCGAGATCCTGTCCTCAATCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134033.1-551s1c1
Sequence:CCGGGACAGGATAATTGACGAAGATCTCGAGATCTTCGTCAATTATCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134033.1-329s1c1
Sequence:CCGGGAGTGTCCAGTAAGAAAGAAACTCGAGTTTCTTTCTTACTGGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134033.1-276s1c1
Sequence:CCGGGACGTGTTTCCATTCACTGTACTCGAGTACAGTGAATGGAAACACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134033.2-738s1c1
Sequence:CCGGGAGGATGATTGAGTCTATGAGCTCGAGCTCATAGACTCAATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-1338s21c1
Sequence:CCGGATCGCCACTGCACCCTAATTGCTCGAGCAATTAGGGTGCAGTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-338s21c1
Sequence:CCGGGACGTGTTTCCATTCACTGTACTCGAGTACAGTGAATGGAAACACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-751s21c1
Sequence:CCGGTCTATGAGCCGTCCTTCTATGCTCGAGCATAGAAGGACGGCTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-432s21c1
Sequence:CCGGCGGTGCAGTTACTGATGAATGCTCGAGCATTCATCAGTAACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134033.2-700s21c1
Sequence:CCGGACGGGTTTGAAGAGGGAATTTCTCGAGAAATTCCCTCTTCAAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks