EMAIL THIS PAGE TO A FRIEND

CCDC11

coiled-coil domain containing 11

82 Gene Product Result for
Synonyms: HTX6
UniProtKB ID: Q96M91, B4DXT1
Gene ID:
Mouse(74453) coiled-coil domain containing 11
Rat(364899) coiled-coil domain containing 11
naked mole-rat(101723743) coiled-coil domain containing 11
domestic guinea pig(100724952) coiled-coil domain containing 11
sheep(101116365) coiled-coil domain containing 11
Zebrafish(567344) coiled-coil domain containing 11
Horse(100053812) coiled-coil domain containing 11
domestic cat(101089551) coiled-coil domain containing 11
dog(490567) coiled-coil domain containing 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145020 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022841 MISSION® esiRNA esiRNA human CCDC11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145020 Rosetta Predictions human pricing
XM_001053914 Rosetta Predictions rat pricing
XM_344700 Rosetta Predictions rat pricing
NM_028948 Rosetta Predictions mouse pricing
XM_128864 Rosetta Predictions mouse pricing
XM_894960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155490 predicted 350
2 SASI_Hs01_00155491 predicted 1363
3 SASI_Hs01_00155493 predicted 629
4 SASI_Hs01_00155494 predicted 1568
5 SASI_Hs01_00155495 predicted 629
6 SASI_Hs01_00155497 predicted 683
7 SASI_Hs01_00155498 predicted 1516
8 SASI_Hs02_00364874 predicted 364
9 SASI_Hs02_00364875 predicted 376
10 SASI_Hs02_00364876 predicted 1567
11 SASI_Hs01_00155489 predicted 759
12 SASI_Hs01_00155492 predicted 1384
13 SASI_Hs01_00155496 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274018 predicted 1334
2 SASI_Rn02_00274019 predicted 1614
3 SASI_Rn02_00274020 predicted 1607
4 SASI_Rn02_00274021 predicted 1551
5 SASI_Rn02_00274022 predicted 736
6 SASI_Rn02_00274023 predicted 1576
7 SASI_Rn02_00274024 predicted 1528
8 SASI_Rn02_00274025 predicted 208
9 SASI_Rn02_00274026 predicted 1434
10 SASI_Rn02_00274027 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397451 predicted 733
2 SASI_Rn02_00397452 predicted 826
3 SASI_Rn02_00397453 predicted 735
4 SASI_Rn02_00397454 predicted 732
5 SASI_Rn02_00397455 predicted 734
6 SASI_Rn02_00397456 predicted 752
7 SASI_Rn02_00397457 predicted 821
8 SASI_Rn02_00397458 predicted 818
9 SASI_Rn02_00397459 predicted 728
10 SASI_Rn02_00397460 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334668 predicted 1225
2 SASI_Mm02_00334669 predicted 1330
3 SASI_Mm02_00334670 predicted 1322
4 SASI_Mm02_00334671 predicted 643
5 SASI_Mm02_00334672 predicted 644
6 SASI_Mm02_00334673 predicted 1384
7 SASI_Mm02_00334674 predicted 1310
8 SASI_Mm02_00334675 predicted 1385
9 SASI_Mm02_00334676 predicted 685
10 SASI_Mm02_00334677 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206305 predicted 1552
2 SASI_Mm01_00206306 predicted 1648
3 SASI_Mm01_00206307 predicted 1651
4 SASI_Mm01_00206308 predicted 969
5 SASI_Mm01_00206309 predicted 975
6 SASI_Mm01_00206310 predicted 953
7 SASI_Mm01_00206311 predicted 1628
8 SASI_Mm01_00206312 predicted 1570
9 SASI_Mm01_00206313 predicted 1003
10 SASI_Mm01_00206314 predicted 1632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282560 predicted 389
2 SASI_Mm01_00282561 predicted 288
3 SASI_Mm01_00282562 predicted 383
4 SASI_Mm01_00282563 predicted 322
5 SASI_Mm01_00282564 predicted 580
6 SASI_Mm01_00282565 predicted 539
7 SASI_Mm01_00282566 predicted 1436
8 SASI_Mm01_00282567 predicted 497
9 SASI_Mm01_00282568 predicted 763
10 SASI_Mm01_00282569 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145020
CCDC11 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 11
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145020.3-1401s21c1
Sequence:CCGGTTGCAAGACGCCAACGTTTAGCTCGAGCTAAACGTTGGCGTCTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145020.3-1634s21c1
Sequence:CCGGTAGTTCCGTGAGCATCAATATCTCGAGATATTGATGCTCACGGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145020.3-216s21c1
Sequence:CCGGGCAGCCATCAGAAGCATAATGCTCGAGCATTATGCTTCTGATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145020.3-343s21c1
Sequence:CCGGGGATGCTGTGCAAGGGTTTATCTCGAGATAAACCCTTGCACAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-989s1c1
Sequence:CCGGCAGCAGGAATACAGAGACGAACTCGAGTTCGTCTCTGTATTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-869s1c1
Sequence:CCGGGAAAGTAACAACGCACAGATTCTCGAGAATCTGTGCGTTGTTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-1435s1c1
Sequence:CCGGGAAGCAACTTCAGATGCAAATCTCGAGATTTGCATCTGAAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-1337s1c1
Sequence:CCGGGCTATGGAACAGAAACACATACTCGAGTATGTGTTTCTGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145020.2-1639s1c1
Sequence:CCGGCCGTGAGCATCAATATATCTTCTCGAGAAGATATATTGATGCTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-880s1c1
Sequence:CCGGCGCACAGATTAAACATGAGAACTCGAGTTCTCATGTTTAATCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145020.2-1006s1c1
Sequence:CCGGCGAACAGGACTTGAACATGAACTCGAGTTCATGTTCAAGTCCTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145020.2-629s1c1
Sequence:CCGGCGGAAAGCACAGATTGCATTTCTCGAGAAATGCAATCTGTGCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145020
CCDC11 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 11
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145020.3-1401s21c1
Sequence:CCGGTTGCAAGACGCCAACGTTTAGCTCGAGCTAAACGTTGGCGTCTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145020.3-1634s21c1
Sequence:CCGGTAGTTCCGTGAGCATCAATATCTCGAGATATTGATGCTCACGGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145020.3-216s21c1
Sequence:CCGGGCAGCCATCAGAAGCATAATGCTCGAGCATTATGCTTCTGATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145020.3-343s21c1
Sequence:CCGGGGATGCTGTGCAAGGGTTTATCTCGAGATAAACCCTTGCACAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-989s1c1
Sequence:CCGGCAGCAGGAATACAGAGACGAACTCGAGTTCGTCTCTGTATTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-869s1c1
Sequence:CCGGGAAAGTAACAACGCACAGATTCTCGAGAATCTGTGCGTTGTTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-1435s1c1
Sequence:CCGGGAAGCAACTTCAGATGCAAATCTCGAGATTTGCATCTGAAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-1337s1c1
Sequence:CCGGGCTATGGAACAGAAACACATACTCGAGTATGTGTTTCTGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145020.2-1639s1c1
Sequence:CCGGCCGTGAGCATCAATATATCTTCTCGAGAAGATATATTGATGCTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-880s1c1
Sequence:CCGGCGCACAGATTAAACATGAGAACTCGAGTTCTCATGTTTAATCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145020.2-1006s1c1
Sequence:CCGGCGAACAGGACTTGAACATGAACTCGAGTTCATGTTCAAGTCCTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145020.2-629s1c1
Sequence:CCGGCGGAAAGCACAGATTGCATTTCTCGAGAAATGCAATCTGTGCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145020
CCDC11 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 11
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145020.3-1401s21c1
Sequence:CCGGTTGCAAGACGCCAACGTTTAGCTCGAGCTAAACGTTGGCGTCTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145020.3-1634s21c1
Sequence:CCGGTAGTTCCGTGAGCATCAATATCTCGAGATATTGATGCTCACGGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145020.3-216s21c1
Sequence:CCGGGCAGCCATCAGAAGCATAATGCTCGAGCATTATGCTTCTGATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145020.3-343s21c1
Sequence:CCGGGGATGCTGTGCAAGGGTTTATCTCGAGATAAACCCTTGCACAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-989s1c1
Sequence:CCGGCAGCAGGAATACAGAGACGAACTCGAGTTCGTCTCTGTATTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-869s1c1
Sequence:CCGGGAAAGTAACAACGCACAGATTCTCGAGAATCTGTGCGTTGTTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-1435s1c1
Sequence:CCGGGAAGCAACTTCAGATGCAAATCTCGAGATTTGCATCTGAAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-1337s1c1
Sequence:CCGGGCTATGGAACAGAAACACATACTCGAGTATGTGTTTCTGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145020.2-1639s1c1
Sequence:CCGGCCGTGAGCATCAATATATCTTCTCGAGAAGATATATTGATGCTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145020.2-880s1c1
Sequence:CCGGCGCACAGATTAAACATGAGAACTCGAGTTCTCATGTTTAATCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145020.2-1006s1c1
Sequence:CCGGCGAACAGGACTTGAACATGAACTCGAGTTCATGTTCAAGTCCTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145020.2-629s1c1
Sequence:CCGGCGGAAAGCACAGATTGCATTTCTCGAGAAATGCAATCTGTGCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028948
CCDC11 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-1235s21c1
Sequence:CCGGCTCTGCATGAACAGCGTATAACTCGAGTTATACGCTGTTCATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-378s21c1
Sequence:CCGGGAGAGAGAGAACCAAGTTATTCTCGAGAATAACTTGGTTCTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-1072s21c1
Sequence:CCGGAGACTACTGGAGGACATAAAGCTCGAGCTTTATGTCCTCCAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-521s21c1
Sequence:CCGGAGGAACGGAATGCGCAGATAGCTCGAGCTATCTGCGCATTCCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-470s21c1
Sequence:CCGGGTGAGGAGCTCCGCACTAAATCTCGAGATTTAGTGCGGAGCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028948
CCDC11 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-1235s21c1
Sequence:CCGGCTCTGCATGAACAGCGTATAACTCGAGTTATACGCTGTTCATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-378s21c1
Sequence:CCGGGAGAGAGAGAACCAAGTTATTCTCGAGAATAACTTGGTTCTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-1072s21c1
Sequence:CCGGAGACTACTGGAGGACATAAAGCTCGAGCTTTATGTCCTCCAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-521s21c1
Sequence:CCGGAGGAACGGAATGCGCAGATAGCTCGAGCTATCTGCGCATTCCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-470s21c1
Sequence:CCGGGTGAGGAGCTCCGCACTAAATCTCGAGATTTAGTGCGGAGCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028948
CCDC11 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-1235s21c1
Sequence:CCGGCTCTGCATGAACAGCGTATAACTCGAGTTATACGCTGTTCATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-378s21c1
Sequence:CCGGGAGAGAGAGAACCAAGTTATTCTCGAGAATAACTTGGTTCTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-1072s21c1
Sequence:CCGGAGACTACTGGAGGACATAAAGCTCGAGCTTTATGTCCTCCAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-521s21c1
Sequence:CCGGAGGAACGGAATGCGCAGATAGCTCGAGCTATCTGCGCATTCCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028948.1-470s21c1
Sequence:CCGGGTGAGGAGCTCCGCACTAAATCTCGAGATTTAGTGCGGAGCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks