EMAIL THIS PAGE TO A FRIEND

CCDC120

coiled-coil domain containing 120

120 Gene Product Result for
UniProtKB ID: Q96HB5, B4DTU2, F5GZU4
Gene ID:
Human(90060) Summary: This gene encodes a protein that contains a coiled-coil domain. Several alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
Mouse(54648) coiled-coil domain containing 120
Rat(317377) coiled-coil domain containing 120
naked mole-rat(101715939) coiled-coil domain containing 120
domestic guinea pig(100733844) coiled-coil domain containing 120
sheep(101113309) coiled-coil domain containing 120
Domestic Rabbit(100347088) coiled-coil domain containing 120
Zebrafish(768286) coiled-coil domain containing 120
cow(508704) coiled-coil domain containing 120
Horse(100062630) coiled-coil domain containing 120
dog(491873) coiled-coil domain containing 120
domestic cat(101099439) coiled-coil domain containing 120
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033626 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207202 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207202 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207202 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033626 Rosetta Predictions human pricing
XM_001063966 Rosetta Predictions rat pricing
XM_228761 Rosetta Predictions rat pricing
NM_207202 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037739 predicted 2153
2 SASI_Hs01_00037740 predicted 837
3 SASI_Hs01_00037741 predicted 2221
4 SASI_Hs01_00037742 predicted 998
5 SASI_Hs01_00037743 predicted 837
6 SASI_Hs01_00037744 predicted 1532
7 SASI_Hs01_00037745 predicted 420
8 SASI_Hs02_00361434 predicted 555
9 SASI_Hs01_00037746 predicted 1163
10 SASI_Hs01_00037747 predicted 1528
11 SASI_Hs01_00037748 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308891 predicted 1354
2 SASI_Rn02_00308892 predicted 598
3 SASI_Rn02_00308893 predicted 1611
4 SASI_Rn02_00308894 predicted 1094
5 SASI_Rn02_00308895 predicted 818
6 SASI_Rn02_00308896 predicted 656
7 SASI_Rn02_00308897 predicted 1648
8 SASI_Rn02_00308898 predicted 314
9 SASI_Rn02_00308899 predicted 1613
10 SASI_Rn02_00308900 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385467 predicted 217
2 SASI_Rn02_00385468 predicted 212
3 SASI_Rn02_00385469 predicted 250
4 SASI_Rn02_00385470 predicted 312
5 SASI_Rn02_00385471 predicted 226
6 SASI_Rn02_00385472 predicted 313
7 SASI_Rn02_00385473 predicted 262
8 SASI_Rn02_00385474 predicted 312
9 SASI_Rn02_00385475 predicted 300
10 SASI_Rn02_00385476 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068375 predicted 985
2 SASI_Mm01_00068376 predicted 1619
3 SASI_Mm01_00068377 predicted 923
4 SASI_Mm02_00351923 predicted 2194
5 SASI_Mm01_00068378 predicted 1080
6 SASI_Mm01_00068380 predicted 2617
7 SASI_Mm01_00068381 predicted 2416
8 SASI_Mm02_00351924 predicted 1114
9 SASI_Mm01_00068382 predicted 1484
10 SASI_Mm01_00068383 predicted 2256
11 SASI_Mm01_00068379 predicted 2437
12 SASI_Mm01_00068384 predicted 2414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033626
CCDC120 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 120
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166502    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033626.2-2658s1c1
Sequence:CCGGCCCTTCTGATATGTCCCTTGTCTCGAGACAAGGGACATATCAGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033626.2-1546s1c1
Sequence:CCGGCCTCTTGGACTATTCCTTGGACTCGAGTCCAAGGAATAGTCCAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033626.2-1170s1c1
Sequence:CCGGGCAAACCTGAAGGCCTTCATTCTCGAGAATGAAGGCCTTCAGGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158665    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033626.2-2916s1c1
Sequence:CCGGCCTCCATTTATGTTTACAGTTCTCGAGAACTGTAAACATAAATGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033626.2-2290s1c1
Sequence:CCGGGCAGCAATTCTTTATCAAGTTCTCGAGAACTTGATAAAGAATTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033626.2-2281s1c1
Sequence:CCGGGCACTGGTAGCAGCAATTCTTCTCGAGAAGAATTGCTGCTACCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033626.2-1010s21c1
Sequence:CCGGCCACCTCCATCAGATCTTTATCTCGAGATAAAGATCTGATGGAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033626.2-2125s21c1
Sequence:CCGGGTAAGGCAGATGGCGAAGATACTCGAGTATCTTCGCCATCTGCCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033626
CCDC120 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 120
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166502    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033626.2-2658s1c1
Sequence:CCGGCCCTTCTGATATGTCCCTTGTCTCGAGACAAGGGACATATCAGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033626.2-1546s1c1
Sequence:CCGGCCTCTTGGACTATTCCTTGGACTCGAGTCCAAGGAATAGTCCAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033626.2-1170s1c1
Sequence:CCGGGCAAACCTGAAGGCCTTCATTCTCGAGAATGAAGGCCTTCAGGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158665    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033626.2-2916s1c1
Sequence:CCGGCCTCCATTTATGTTTACAGTTCTCGAGAACTGTAAACATAAATGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033626.2-2290s1c1
Sequence:CCGGGCAGCAATTCTTTATCAAGTTCTCGAGAACTTGATAAAGAATTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033626.2-2281s1c1
Sequence:CCGGGCACTGGTAGCAGCAATTCTTCTCGAGAAGAATTGCTGCTACCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033626.2-1010s21c1
Sequence:CCGGCCACCTCCATCAGATCTTTATCTCGAGATAAAGATCTGATGGAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033626.2-2125s21c1
Sequence:CCGGGTAAGGCAGATGGCGAAGATACTCGAGTATCTTCGCCATCTGCCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033626
CCDC120 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 120
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166502    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033626.2-2658s1c1
Sequence:CCGGCCCTTCTGATATGTCCCTTGTCTCGAGACAAGGGACATATCAGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033626.2-1546s1c1
Sequence:CCGGCCTCTTGGACTATTCCTTGGACTCGAGTCCAAGGAATAGTCCAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033626.2-1170s1c1
Sequence:CCGGGCAAACCTGAAGGCCTTCATTCTCGAGAATGAAGGCCTTCAGGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158665    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033626.2-2916s1c1
Sequence:CCGGCCTCCATTTATGTTTACAGTTCTCGAGAACTGTAAACATAAATGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033626.2-2290s1c1
Sequence:CCGGGCAGCAATTCTTTATCAAGTTCTCGAGAACTTGATAAAGAATTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033626.2-2281s1c1
Sequence:CCGGGCACTGGTAGCAGCAATTCTTCTCGAGAAGAATTGCTGCTACCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033626.2-1010s21c1
Sequence:CCGGCCACCTCCATCAGATCTTTATCTCGAGATAAAGATCTGATGGAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033626.2-2125s21c1
Sequence:CCGGGTAAGGCAGATGGCGAAGATACTCGAGTATCTTCGCCATCTGCCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207202
CCDC120 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 120
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207202.2-2507s1c1
Sequence:CCGGCCACCTCTTTAACAGCTTCTTCTCGAGAAGAAGCTGTTAAAGAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207202.2-915s1c1
Sequence:CCGGCCAAGAGGATGTAGTTCTGCACTCGAGTGCAGAACTACATCCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207202.2-1089s1c1
Sequence:CCGGGAAACCTCCACCATCAGATATCTCGAGATATCTGATGGTGGAGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207202.2-2191s1c1
Sequence:CCGGGATGGGTAGGGTTATTGATTCCTCGAGGAATCAATAACCCTACCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207202.2-1756s21c1
Sequence:CCGGCCAGGTCCTCCACCCATATATCTCGAGATATATGGGTGGAGGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207202.2-2398s21c1
Sequence:CCGGGAGCCTTGAAGTCCGGGTAATCTCGAGATTACCCGGACTTCAAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207202.2-665s21c1
Sequence:CCGGTATCGGTGCAGCAGCAGATTGCTCGAGCAATCTGCTGCTGCACCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207202.2-975s21c1
Sequence:CCGGTGATAACGAGGAGCCTCATAGCTCGAGCTATGAGGCTCCTCGTTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207202.2-1622s21c1
Sequence:CCGGGAGACTTCCTCTTGGACTATCCTCGAGGATAGTCCAAGAGGAAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207202
CCDC120 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 120
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207202.2-2507s1c1
Sequence:CCGGCCACCTCTTTAACAGCTTCTTCTCGAGAAGAAGCTGTTAAAGAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207202.2-915s1c1
Sequence:CCGGCCAAGAGGATGTAGTTCTGCACTCGAGTGCAGAACTACATCCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207202.2-1089s1c1
Sequence:CCGGGAAACCTCCACCATCAGATATCTCGAGATATCTGATGGTGGAGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207202.2-2191s1c1
Sequence:CCGGGATGGGTAGGGTTATTGATTCCTCGAGGAATCAATAACCCTACCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207202.2-1756s21c1
Sequence:CCGGCCAGGTCCTCCACCCATATATCTCGAGATATATGGGTGGAGGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207202.2-2398s21c1
Sequence:CCGGGAGCCTTGAAGTCCGGGTAATCTCGAGATTACCCGGACTTCAAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207202.2-665s21c1
Sequence:CCGGTATCGGTGCAGCAGCAGATTGCTCGAGCAATCTGCTGCTGCACCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207202.2-975s21c1
Sequence:CCGGTGATAACGAGGAGCCTCATAGCTCGAGCTATGAGGCTCCTCGTTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207202.2-1622s21c1
Sequence:CCGGGAGACTTCCTCTTGGACTATCCTCGAGGATAGTCCAAGAGGAAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207202
CCDC120 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 120
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207202.2-2507s1c1
Sequence:CCGGCCACCTCTTTAACAGCTTCTTCTCGAGAAGAAGCTGTTAAAGAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207202.2-915s1c1
Sequence:CCGGCCAAGAGGATGTAGTTCTGCACTCGAGTGCAGAACTACATCCTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207202.2-1089s1c1
Sequence:CCGGGAAACCTCCACCATCAGATATCTCGAGATATCTGATGGTGGAGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207202.2-2191s1c1
Sequence:CCGGGATGGGTAGGGTTATTGATTCCTCGAGGAATCAATAACCCTACCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207202.2-1756s21c1
Sequence:CCGGCCAGGTCCTCCACCCATATATCTCGAGATATATGGGTGGAGGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207202.2-2398s21c1
Sequence:CCGGGAGCCTTGAAGTCCGGGTAATCTCGAGATTACCCGGACTTCAAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207202.2-665s21c1
Sequence:CCGGTATCGGTGCAGCAGCAGATTGCTCGAGCAATCTGCTGCTGCACCGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207202.2-975s21c1
Sequence:CCGGTGATAACGAGGAGCCTCATAGCTCGAGCTATGAGGCTCCTCGTTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207202.2-1622s21c1
Sequence:CCGGGAGACTTCCTCTTGGACTATCCTCGAGGATAGTCCAAGAGGAAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)