EMAIL THIS PAGE TO A FRIEND

CCDC121

coiled-coil domain containing 121

66 Gene Product Result for
UniProtKB ID: Q6ZUS5, B3KW66, J3KQZ8, Q9H8G6
Gene ID:
Mouse(403180) coiled-coil domain containing 121
Rat(289329) coiled-coil domain containing 121
chicken(426291) coiled-coil domain containing 121
dog(475706) coiled-coil domain containing 121
cow(782407) coiled-coil domain containing 121
domestic cat(101090096) coiled-coil domain containing 121
sheep(101112804) coiled-coil domain containing 121
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207280 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207280 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207280 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024584 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024584 Rosetta Predictions human pricing
XM_001062881 Rosetta Predictions rat pricing
XM_223007 Rosetta Predictions rat pricing
XM_619714 Rosetta Predictions mouse pricing
XM_906534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160605 predicted 825
2 SASI_Hs01_00160606 predicted 873
3 SASI_Hs01_00160607 predicted 466
4 SASI_Hs01_00160608 predicted 298
5 SASI_Hs01_00160609 predicted 784
6 SASI_Hs01_00160610 predicted 1051
7 SASI_Hs01_00160611 predicted 492
8 SASI_Hs02_00356918 predicted 558
9 SASI_Hs01_00160612 predicted 1092
10 SASI_Hs01_00160613 predicted 345
11 SASI_Hs01_00160614 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304954 predicted 473
2 SASI_Rn02_00304955 predicted 488
3 SASI_Rn02_00304956 predicted 722
4 SASI_Rn02_00304957 predicted 532
5 SASI_Rn02_00304958 predicted 286
6 SASI_Rn02_00304959 predicted 448
7 SASI_Rn02_00304960 predicted 388
8 SASI_Rn02_00304961 predicted 384
9 SASI_Rn02_00304962 predicted 551
10 SASI_Rn02_00304963 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381044 predicted 494
2 SASI_Rn02_00381045 predicted 503
3 SASI_Rn02_00381046 predicted 730
4 SASI_Rn02_00381047 predicted 553
5 SASI_Rn02_00381048 predicted 301
6 SASI_Rn02_00381049 predicted 463
7 SASI_Rn02_00381050 predicted 406
8 SASI_Rn02_00381051 predicted 399
9 SASI_Rn02_00381052 predicted 562
10 SASI_Rn02_00381053 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427490 predicted 1038
2 SASI_Mm02_00427491 predicted 1058
3 SASI_Mm01_00224852 predicted 660
4 SASI_Mm01_00224853 predicted 739
5 SASI_Mm02_00427492 predicted 929
6 SASI_Mm01_00224856 predicted 572
7 SASI_Mm01_00224857 predicted 409
8 SASI_Mm02_00427493 predicted 1052
9 SASI_Mm01_00224858 predicted 301
10 SASI_Mm01_00224860 predicted 372
11 SASI_Mm01_00224851 predicted 751
12 SASI_Mm01_00224854 predicted 517
13 SASI_Mm01_00224855 predicted 512
14 SASI_Mm01_00224859 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432574 predicted 1038
2 SASI_Mm02_00432575 predicted 1061
3 SASI_Mm02_00432576 predicted 658
4 SASI_Mm02_00432577 predicted 740
5 SASI_Mm02_00432578 predicted 928
6 SASI_Mm02_00432579 predicted 573
7 SASI_Mm02_00432580 predicted 415
8 SASI_Mm02_00432581 predicted 1050
9 SASI_Mm02_00432582 predicted 308
10 SASI_Mm02_00432583 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207280
CCDC121 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 121
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207280.2-397s21c1
Sequence:CCGGGAACGCGAGAGACAAGAATTGCTCGAGCAATTCTTGTCTCTCGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207280.2-1345s21c1
Sequence:CCGGGTCCACAAAGTATAGTGTATACTCGAGTATACACTATACTTTGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207280.2-512s21c1
Sequence:CCGGTGAAGCCAGTTTACAAGATAACTCGAGTTATCTTGTAAACTGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207280.2-1198s21c1
Sequence:CCGGTGTTGTAGATTCCGGAGATTTCTCGAGAAATCTCCGGAATCTACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207280.2-307s21c1
Sequence:CCGGTTCATGGAATACCTGCGTAAACTCGAGTTTACGCAGGTATTCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207280.2-100s21c1
Sequence:CCGGCCAACACCACACCTTACTATTCTCGAGAATAGTAAGGTGTGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207280
CCDC121 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 121
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207280.2-397s21c1
Sequence:CCGGGAACGCGAGAGACAAGAATTGCTCGAGCAATTCTTGTCTCTCGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207280.2-1345s21c1
Sequence:CCGGGTCCACAAAGTATAGTGTATACTCGAGTATACACTATACTTTGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207280.2-512s21c1
Sequence:CCGGTGAAGCCAGTTTACAAGATAACTCGAGTTATCTTGTAAACTGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207280.2-1198s21c1
Sequence:CCGGTGTTGTAGATTCCGGAGATTTCTCGAGAAATCTCCGGAATCTACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207280.2-307s21c1
Sequence:CCGGTTCATGGAATACCTGCGTAAACTCGAGTTTACGCAGGTATTCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207280.2-100s21c1
Sequence:CCGGCCAACACCACACCTTACTATTCTCGAGAATAGTAAGGTGTGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207280
CCDC121 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 121
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207280.2-397s21c1
Sequence:CCGGGAACGCGAGAGACAAGAATTGCTCGAGCAATTCTTGTCTCTCGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207280.2-1345s21c1
Sequence:CCGGGTCCACAAAGTATAGTGTATACTCGAGTATACACTATACTTTGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207280.2-512s21c1
Sequence:CCGGTGAAGCCAGTTTACAAGATAACTCGAGTTATCTTGTAAACTGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207280.2-1198s21c1
Sequence:CCGGTGTTGTAGATTCCGGAGATTTCTCGAGAAATCTCCGGAATCTACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207280.2-307s21c1
Sequence:CCGGTTCATGGAATACCTGCGTAAACTCGAGTTTACGCAGGTATTCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207280.2-100s21c1
Sequence:CCGGCCAACACCACACCTTACTATTCTCGAGAATAGTAAGGTGTGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024584
VALIDATED
CCDC121 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 121
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024584.3-779s21c1
Sequence:CCGGCAGCAGTTCAAGAAGGAATTACTCGAGTAATTCCTTCTTGAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024584.3-930s21c1
Sequence:CCGGGTCATAATCAGTGCCTAAATACTCGAGTATTTAGGCACTGATTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024584.3-1723s21c1
Sequence:CCGGGCCTCCACTTATTTCAGGAAACTCGAGTTTCCTGAAATAAGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024584.3-725s21c1
Sequence:CCGGTTGGCAGCAAAGCGGTTTATTCTCGAGAATAAACCGCTTTGCTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024584.3-884s21c1
Sequence:CCGGTGGTATCTGGAGTCCTTAATCCTCGAGGATTAAGGACTCCAGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024584.2-1612s1c1
Sequence:CCGGCCTACAAGTTTGAGAAGGTAACTCGAGTTACCTTCTCAAACTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024584.2-833s1c1
Sequence:CCGGGCTACTCAAAGCCACTTAGAACTCGAGTTCTAAGTGGCTTTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024584.2-1723s1c1
Sequence:CCGGGCCTCCACTTATTTCAGGAAACTCGAGTTTCCTGAAATAAGTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024584.2-779s1c1
Sequence:CCGGCAGCAGTTCAAGAAGGAATTACTCGAGTAATTCCTTCTTGAACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024584
VALIDATED
CCDC121 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 121
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024584.3-779s21c1
Sequence:CCGGCAGCAGTTCAAGAAGGAATTACTCGAGTAATTCCTTCTTGAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024584.3-930s21c1
Sequence:CCGGGTCATAATCAGTGCCTAAATACTCGAGTATTTAGGCACTGATTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024584.3-1723s21c1
Sequence:CCGGGCCTCCACTTATTTCAGGAAACTCGAGTTTCCTGAAATAAGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024584.3-725s21c1
Sequence:CCGGTTGGCAGCAAAGCGGTTTATTCTCGAGAATAAACCGCTTTGCTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024584.3-884s21c1
Sequence:CCGGTGGTATCTGGAGTCCTTAATCCTCGAGGATTAAGGACTCCAGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024584.2-1612s1c1
Sequence:CCGGCCTACAAGTTTGAGAAGGTAACTCGAGTTACCTTCTCAAACTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024584.2-833s1c1
Sequence:CCGGGCTACTCAAAGCCACTTAGAACTCGAGTTCTAAGTGGCTTTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024584.2-1723s1c1
Sequence:CCGGGCCTCCACTTATTTCAGGAAACTCGAGTTTCCTGAAATAAGTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024584.2-779s1c1
Sequence:CCGGCAGCAGTTCAAGAAGGAATTACTCGAGTAATTCCTTCTTGAACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024584
VALIDATED
CCDC121 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 121
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024584.3-779s21c1
Sequence:CCGGCAGCAGTTCAAGAAGGAATTACTCGAGTAATTCCTTCTTGAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024584.3-930s21c1
Sequence:CCGGGTCATAATCAGTGCCTAAATACTCGAGTATTTAGGCACTGATTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024584.3-1723s21c1
Sequence:CCGGGCCTCCACTTATTTCAGGAAACTCGAGTTTCCTGAAATAAGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024584.3-725s21c1
Sequence:CCGGTTGGCAGCAAAGCGGTTTATTCTCGAGAATAAACCGCTTTGCTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024584.3-884s21c1
Sequence:CCGGTGGTATCTGGAGTCCTTAATCCTCGAGGATTAAGGACTCCAGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024584.2-1612s1c1
Sequence:CCGGCCTACAAGTTTGAGAAGGTAACTCGAGTTACCTTCTCAAACTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024584.2-833s1c1
Sequence:CCGGGCTACTCAAAGCCACTTAGAACTCGAGTTCTAAGTGGCTTTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024584.2-1723s1c1
Sequence:CCGGGCCTCCACTTATTTCAGGAAACTCGAGTTTCCTGAAATAAGTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024584.2-779s1c1
Sequence:CCGGCAGCAGTTCAAGAAGGAATTACTCGAGTAATTCCTTCTTGAACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks