EMAIL THIS PAGE TO A FRIEND

CCDC122

coiled-coil domain containing 122

33 Gene Product Result for
UniProtKB ID: Q5T0U0, B2RP70, B7ZMI9, Q96MV0
Gene ID:
Mouse(108811) coiled-coil domain containing 122
Rat(100360752) coiled-coil domain containing 122
domestic guinea pig(100733265) coiled-coil domain containing 122
sheep(101102572) coiled-coil domain containing 122
chicken(428068) coiled-coil domain containing 122
dog(485460) coiled-coil domain containing 122
domestic cat(101086530) coiled-coil domain containing 122
cow(525313) coiled-coil domain containing 122
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144974 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144974 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144974 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144974 Rosetta Predictions human pricing
NM_175369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364766 predicted 622
2 SASI_Hs02_00364767 predicted 810
3 SASI_Hs02_00364768 predicted 757
4 SASI_Hs02_00364769 predicted 935
5 SASI_Hs02_00364770 predicted 1061
6 SASI_Hs02_00364771 predicted 460
7 SASI_Hs02_00364772 predicted 1071
8 SASI_Hs02_00364773 predicted 943
9 SASI_Hs02_00364774 predicted 475
10 SASI_Hs02_00364775 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346169 predicted 538
2 SASI_Mm02_00346170 predicted 434
3 SASI_Mm02_00346171 predicted 537
4 SASI_Mm02_00346172 predicted 914
5 SASI_Mm02_00346173 predicted 674
6 SASI_Mm02_00346174 predicted 806
7 SASI_Mm02_00346175 predicted 678
8 SASI_Mm02_00346176 predicted 926
9 SASI_Mm02_00346177 predicted 532
10 SASI_Mm02_00346178 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144974
CCDC122 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 122
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144974.1-330s1c1
Sequence:CCGGGCTGATGCTGTAGAGAAAGTTCTCGAGAACTTTCTCTACAGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144974.1-315s1c1
Sequence:CCGGGACACAAGTTCATTAGCTGATCTCGAGATCAGCTAATGAACTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144974.1-794s1c1
Sequence:CCGGGAACCGAATAACACAAGTACACTCGAGTGTACTTGTGTTATTCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144974.1-367s1c1
Sequence:CCGGCACAAGCATCAGAGATAGAAACTCGAGTTTCTATCTCTGATGCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144974.1-504s1c1
Sequence:CCGGGCCATAGAGAATACCAAACTTCTCGAGAAGTTTGGTATTCTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144974.1-3353s1c1
Sequence:CCGGGCTCCTAGATTCACTGATCTTCTCGAGAAGATCAGTGAATCTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144974.3-1317s21c1
Sequence:CCGGCAAGAGTCTCTGTGACTATTTCTCGAGAAATAGTCACAGAGACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144974.3-1066s21c1
Sequence:CCGGTGGAATGCAAGAGTAACATTGCTCGAGCAATGTTACTCTTGCATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144974.3-683s21c1
Sequence:CCGGGTAGAGAGCAAATGGTCATTTCTCGAGAAATGACCATTTGCTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144974.3-938s21c1
Sequence:CCGGCATAAGAGGTATGATGCAATTCTCGAGAATTGCATCATACCTCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144974
CCDC122 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 122
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144974.1-330s1c1
Sequence:CCGGGCTGATGCTGTAGAGAAAGTTCTCGAGAACTTTCTCTACAGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144974.1-315s1c1
Sequence:CCGGGACACAAGTTCATTAGCTGATCTCGAGATCAGCTAATGAACTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144974.1-794s1c1
Sequence:CCGGGAACCGAATAACACAAGTACACTCGAGTGTACTTGTGTTATTCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144974.1-367s1c1
Sequence:CCGGCACAAGCATCAGAGATAGAAACTCGAGTTTCTATCTCTGATGCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144974.1-504s1c1
Sequence:CCGGGCCATAGAGAATACCAAACTTCTCGAGAAGTTTGGTATTCTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144974.1-3353s1c1
Sequence:CCGGGCTCCTAGATTCACTGATCTTCTCGAGAAGATCAGTGAATCTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144974.3-1317s21c1
Sequence:CCGGCAAGAGTCTCTGTGACTATTTCTCGAGAAATAGTCACAGAGACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144974.3-1066s21c1
Sequence:CCGGTGGAATGCAAGAGTAACATTGCTCGAGCAATGTTACTCTTGCATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144974.3-683s21c1
Sequence:CCGGGTAGAGAGCAAATGGTCATTTCTCGAGAAATGACCATTTGCTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144974.3-938s21c1
Sequence:CCGGCATAAGAGGTATGATGCAATTCTCGAGAATTGCATCATACCTCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144974
CCDC122 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 122
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144974.1-330s1c1
Sequence:CCGGGCTGATGCTGTAGAGAAAGTTCTCGAGAACTTTCTCTACAGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144974.1-315s1c1
Sequence:CCGGGACACAAGTTCATTAGCTGATCTCGAGATCAGCTAATGAACTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144974.1-794s1c1
Sequence:CCGGGAACCGAATAACACAAGTACACTCGAGTGTACTTGTGTTATTCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144974.1-367s1c1
Sequence:CCGGCACAAGCATCAGAGATAGAAACTCGAGTTTCTATCTCTGATGCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144974.1-504s1c1
Sequence:CCGGGCCATAGAGAATACCAAACTTCTCGAGAAGTTTGGTATTCTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144974.1-3353s1c1
Sequence:CCGGGCTCCTAGATTCACTGATCTTCTCGAGAAGATCAGTGAATCTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144974.3-1317s21c1
Sequence:CCGGCAAGAGTCTCTGTGACTATTTCTCGAGAAATAGTCACAGAGACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144974.3-1066s21c1
Sequence:CCGGTGGAATGCAAGAGTAACATTGCTCGAGCAATGTTACTCTTGCATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144974.3-683s21c1
Sequence:CCGGGTAGAGAGCAAATGGTCATTTCTCGAGAAATGACCATTTGCTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144974.3-938s21c1
Sequence:CCGGCATAAGAGGTATGATGCAATTCTCGAGAATTGCATCATACCTCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175369
CCDC122 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 122
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175369.2-493s1c1
Sequence:CCGGGCTGCAATGGAGAACTCTAAACTCGAGTTTAGAGTTCTCCATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175369.2-963s1c1
Sequence:CCGGGCATTGTCAGATGAACAAGATCTCGAGATCTTGTTCATCTGACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175369.2-532s1c1
Sequence:CCGGGAAGCTCAAATTGAGTCCTTACTCGAGTAAGGACTCAATTTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175369.3-1425s1c1
Sequence:CCGGGATGTAAGTTGCTGAGATAAACTCGAGTTTATCTCAGCAACTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175369.3-930s1c1
Sequence:CCGGCATAAGAGATATGATGCAATTCTCGAGAATTGCATCATATCTCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175369.3-1426s21c1
Sequence:CCGGATGTAAGTTGCTGAGATAAATCTCGAGATTTATCTCAGCAACTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175369.3-971s21c1
Sequence:CCGGGATGAACAAGATTCAGTTAAACTCGAGTTTAACTGAATCTTGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175369.3-740s21c1
Sequence:CCGGGACAATGAAAGAAGATCTTATCTCGAGATAAGATCTTCTTTCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175369.3-930s21c1
Sequence:CCGGCATAAGAGATATGATGCAATTCTCGAGAATTGCATCATATCTCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175369.3-535s21c1
Sequence:CCGGCTCAAATTGAGTCCTTATATTCTCGAGAATATAAGGACTCAATTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175369
CCDC122 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 122
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175369.2-493s1c1
Sequence:CCGGGCTGCAATGGAGAACTCTAAACTCGAGTTTAGAGTTCTCCATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175369.2-963s1c1
Sequence:CCGGGCATTGTCAGATGAACAAGATCTCGAGATCTTGTTCATCTGACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175369.2-532s1c1
Sequence:CCGGGAAGCTCAAATTGAGTCCTTACTCGAGTAAGGACTCAATTTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175369.3-1425s1c1
Sequence:CCGGGATGTAAGTTGCTGAGATAAACTCGAGTTTATCTCAGCAACTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175369.3-930s1c1
Sequence:CCGGCATAAGAGATATGATGCAATTCTCGAGAATTGCATCATATCTCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175369.3-1426s21c1
Sequence:CCGGATGTAAGTTGCTGAGATAAATCTCGAGATTTATCTCAGCAACTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175369.3-971s21c1
Sequence:CCGGGATGAACAAGATTCAGTTAAACTCGAGTTTAACTGAATCTTGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175369.3-740s21c1
Sequence:CCGGGACAATGAAAGAAGATCTTATCTCGAGATAAGATCTTCTTTCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175369.3-930s21c1
Sequence:CCGGCATAAGAGATATGATGCAATTCTCGAGAATTGCATCATATCTCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175369.3-535s21c1
Sequence:CCGGCTCAAATTGAGTCCTTATATTCTCGAGAATATAAGGACTCAATTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175369
CCDC122 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 122
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175369.2-493s1c1
Sequence:CCGGGCTGCAATGGAGAACTCTAAACTCGAGTTTAGAGTTCTCCATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175369.2-963s1c1
Sequence:CCGGGCATTGTCAGATGAACAAGATCTCGAGATCTTGTTCATCTGACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175369.2-532s1c1
Sequence:CCGGGAAGCTCAAATTGAGTCCTTACTCGAGTAAGGACTCAATTTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175369.3-1425s1c1
Sequence:CCGGGATGTAAGTTGCTGAGATAAACTCGAGTTTATCTCAGCAACTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175369.3-930s1c1
Sequence:CCGGCATAAGAGATATGATGCAATTCTCGAGAATTGCATCATATCTCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175369.3-1426s21c1
Sequence:CCGGATGTAAGTTGCTGAGATAAATCTCGAGATTTATCTCAGCAACTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175369.3-971s21c1
Sequence:CCGGGATGAACAAGATTCAGTTAAACTCGAGTTTAACTGAATCTTGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175369.3-740s21c1
Sequence:CCGGGACAATGAAAGAAGATCTTATCTCGAGATAAGATCTTCTTTCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175369.3-930s21c1
Sequence:CCGGCATAAGAGATATGATGCAATTCTCGAGAATTGCATCATATCTCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175369.3-535s21c1
Sequence:CCGGCTCAAATTGAGTCCTTATATTCTCGAGAATATAAGGACTCAATTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks