EMAIL THIS PAGE TO A FRIEND

CCDC124

coiled-coil domain containing 124

50 Gene Product Result for
UniProtKB ID: Q96CT7
Gene ID:
Mouse(234388) coiled-coil domain containing 124
Rat(290642) coiled-coil domain containing 124
Zebrafish(393537) coiled-coil domain containing 124
chicken(427087) coiled-coil domain containing 124
cow(510778) coiled-coil domain containing 124
domestic cat(101085356) coiled-coil domain containing 124
dog(476671) coiled-coil domain containing 124
sheep(101110586) coiled-coil domain containing 124
domestic guinea pig(100733300) coiled-coil domain containing 124
naked mole-rat(101717207) coiled-coil domain containing 124
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136203 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138442 Rosetta Predictions human pricing
NM_001106071 Rosetta Predictions rat pricing
NM_026964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022864 predicted 642
2 SASI_Hs02_00363605 predicted 581
3 SASI_Hs02_00363606 predicted 578
4 SASI_Hs01_00022865 predicted 407
5 SASI_Hs01_00022866 predicted 535
6 SASI_Hs01_00022867 predicted 744
7 SASI_Hs01_00022869 predicted 714
8 SASI_Hs01_00022870 predicted 587
9 SASI_Hs01_00022871 predicted 622
10 SASI_Hs01_00022872 predicted 309
11 SASI_Hs01_00022868 predicted 459
12 SASI_Hs01_00022873 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215342 predicted 483
2 SASI_Rn02_00215343 predicted 1161
3 SASI_Rn02_00215344 predicted 1312
4 SASI_Rn02_00215345 predicted 1192
5 SASI_Rn02_00215346 predicted 1143
6 SASI_Rn02_00215347 predicted 608
7 SASI_Rn02_00215348 predicted 896
8 SASI_Rn02_00215349 predicted 941
9 SASI_Rn02_00215350 predicted 737
10 SASI_Rn02_00215351 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147040 predicted 544
2 SASI_Mm01_00147041 predicted 539
3 SASI_Mm01_00147042 predicted 299
4 SASI_Mm01_00147043 predicted 270
5 SASI_Mm01_00147044 predicted 317
6 SASI_Mm01_00147045 predicted 259
7 SASI_Mm01_00147046 predicted 393
8 SASI_Mm01_00147047 predicted 589
9 SASI_Mm02_00331284 predicted 645
10 SASI_Mm02_00331285 predicted 668
11 SASI_Mm01_00147048 predicted 605
12 SASI_Mm01_00147049 predicted 412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136203
VALIDATED
CCDC124 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 124
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136203.1-633s21c1
Sequence:CCGGGAAACAGCTGCTCAAGAAGGACTCGAGTCCTTCTTGAGCAGCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136203.1-760s21c1
Sequence:CCGGTCACGACTCTGCACGCCCTTACTCGAGTAAGGGCGTGCAGAGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136203.1-227s21c1
Sequence:CCGGTCGACCAGCTGGAACGTAAGACTCGAGTCTTACGTTCCAGCTGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136203.1-396s21c1
Sequence:CCGGCGAGAAAGCCAAGAGCCATCTCTCGAGAGATGGCTCTTGGCTTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136203.1-158s21c1
Sequence:CCGGACTGGAAGGACGACGACAAACCTCGAGGTTTGTCGTCGTCCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136203
VALIDATED
CCDC124 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 124
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136203.1-633s21c1
Sequence:CCGGGAAACAGCTGCTCAAGAAGGACTCGAGTCCTTCTTGAGCAGCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136203.1-760s21c1
Sequence:CCGGTCACGACTCTGCACGCCCTTACTCGAGTAAGGGCGTGCAGAGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136203.1-227s21c1
Sequence:CCGGTCGACCAGCTGGAACGTAAGACTCGAGTCTTACGTTCCAGCTGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136203.1-396s21c1
Sequence:CCGGCGAGAAAGCCAAGAGCCATCTCTCGAGAGATGGCTCTTGGCTTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136203.1-158s21c1
Sequence:CCGGACTGGAAGGACGACGACAAACCTCGAGGTTTGTCGTCGTCCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136203
VALIDATED
CCDC124 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 124
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136203.1-633s21c1
Sequence:CCGGGAAACAGCTGCTCAAGAAGGACTCGAGTCCTTCTTGAGCAGCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136203.1-760s21c1
Sequence:CCGGTCACGACTCTGCACGCCCTTACTCGAGTAAGGGCGTGCAGAGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136203.1-227s21c1
Sequence:CCGGTCGACCAGCTGGAACGTAAGACTCGAGTCTTACGTTCCAGCTGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136203.1-396s21c1
Sequence:CCGGCGAGAAAGCCAAGAGCCATCTCTCGAGAGATGGCTCTTGGCTTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136203.1-158s21c1
Sequence:CCGGACTGGAAGGACGACGACAAACCTCGAGGTTTGTCGTCGTCCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026964
VALIDATED
CCDC124 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 124
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026964.2-118s1c1
Sequence:CCGGCGCTGATGCCAAGAAACAGAACTCGAGTTCTGTTTCTTGGCATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026964.2-119s1c1
Sequence:CCGGGCTGATGCCAAGAAACAGAAGCTCGAGCTTCTGTTTCTTGGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026964.2-130s1c1
Sequence:CCGGGAAACAGAAGGAGCTGGAAGACTCGAGTCTTCCAGCTCCTTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026964.2-136s1c1
Sequence:CCGGGAAGGAGCTGGAAGATGCTTACTCGAGTAAGCATCTTCCAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026964.2-406s1c1
Sequence:CCGGGCCACTGGAAGAGAACCTTAACTCGAGTTAAGGTTCTCTTCCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026964.2-142s1c1
Sequence:CCGGGCTGGAAGATGCTTACTGGAACTCGAGTTCCAGTAAGCATCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198906    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026964.2-800s1c1
Sequence:CCGGGCCATAGGTCATCCTCAACAACTCGAGTTGTTGAGGATGACCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026964.2-127s1c1
Sequence:CCGGCAAGAAACAGAAGGAGCTGGACTCGAGTCCAGCTCCTTCTGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026964.2-153s1c1
Sequence:CCGGCTTACTGGAAGGATGAGGACACTCGAGTGTCCTCATCCTTCCAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026964
VALIDATED
CCDC124 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 124
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026964.2-118s1c1
Sequence:CCGGCGCTGATGCCAAGAAACAGAACTCGAGTTCTGTTTCTTGGCATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026964.2-119s1c1
Sequence:CCGGGCTGATGCCAAGAAACAGAAGCTCGAGCTTCTGTTTCTTGGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026964.2-130s1c1
Sequence:CCGGGAAACAGAAGGAGCTGGAAGACTCGAGTCTTCCAGCTCCTTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026964.2-136s1c1
Sequence:CCGGGAAGGAGCTGGAAGATGCTTACTCGAGTAAGCATCTTCCAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026964.2-406s1c1
Sequence:CCGGGCCACTGGAAGAGAACCTTAACTCGAGTTAAGGTTCTCTTCCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026964.2-142s1c1
Sequence:CCGGGCTGGAAGATGCTTACTGGAACTCGAGTTCCAGTAAGCATCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198906    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026964.2-800s1c1
Sequence:CCGGGCCATAGGTCATCCTCAACAACTCGAGTTGTTGAGGATGACCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026964.2-127s1c1
Sequence:CCGGCAAGAAACAGAAGGAGCTGGACTCGAGTCCAGCTCCTTCTGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026964.2-153s1c1
Sequence:CCGGCTTACTGGAAGGATGAGGACACTCGAGTGTCCTCATCCTTCCAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026964
VALIDATED
CCDC124 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 124
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026964.2-118s1c1
Sequence:CCGGCGCTGATGCCAAGAAACAGAACTCGAGTTCTGTTTCTTGGCATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026964.2-119s1c1
Sequence:CCGGGCTGATGCCAAGAAACAGAAGCTCGAGCTTCTGTTTCTTGGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026964.2-130s1c1
Sequence:CCGGGAAACAGAAGGAGCTGGAAGACTCGAGTCTTCCAGCTCCTTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026964.2-136s1c1
Sequence:CCGGGAAGGAGCTGGAAGATGCTTACTCGAGTAAGCATCTTCCAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026964.2-406s1c1
Sequence:CCGGGCCACTGGAAGAGAACCTTAACTCGAGTTAAGGTTCTCTTCCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026964.2-142s1c1
Sequence:CCGGGCTGGAAGATGCTTACTGGAACTCGAGTTCCAGTAAGCATCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198906    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026964.2-800s1c1
Sequence:CCGGGCCATAGGTCATCCTCAACAACTCGAGTTGTTGAGGATGACCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026964.2-127s1c1
Sequence:CCGGCAAGAAACAGAAGGAGCTGGACTCGAGTCCAGCTCCTTCTGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026964.2-153s1c1
Sequence:CCGGCTTACTGGAAGGATGAGGACACTCGAGTGTCCTCATCCTTCCAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks