EMAIL THIS PAGE TO A FRIEND

CCDC125

coiled-coil domain containing 125

64 Gene Product Result for
Synonyms: KENAE
UniProtKB ID: Q86Z20, Q86Z19
Gene ID:
Mouse(76041) coiled-coil domain containing 125
Rat(499518) coiled-coil domain containing 125
naked mole-rat(101719852) coiled-coil domain containing 125
domestic guinea pig(100726783) coiled-coil domain containing 125
sheep(101119672) coiled-coil domain containing 125
Zebrafish(565477) coiled-coil domain containing 125
chicken(427313) coiled-coil domain containing 125
cow(515328) coiled-coil domain containing 125
Horse(100055798) coiled-coil domain containing 125
domestic cat(101088548) coiled-coil domain containing 125
dog(487239) coiled-coil domain containing 125
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041878 Anti-CCDC125 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_176816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176816 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013441 MISSION® esiRNA esiRNA targeting human CCDC125 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176816 Rosetta Predictions human pricing
NM_001134761 Rosetta Predictions rat pricing
XM_001062586 Rosetta Predictions rat pricing
NM_183115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369239 predicted 678
2 SASI_Hs01_00102938 predicted 440
3 SASI_Hs01_00102939 predicted 1118
4 SASI_Hs01_00102941 predicted 1059
5 SASI_Hs01_00102943 predicted 1241
6 SASI_Hs01_00102944 predicted 509
7 SASI_Hs01_00102945 predicted 1308
8 SASI_Hs01_00102946 predicted 209
9 SASI_Hs02_00369240 predicted 1015
10 SASI_Hs02_00369241 predicted 948
11 SASI_Hs01_00102937 predicted 367
12 SASI_Hs01_00102940 predicted 1112
13 SASI_Hs01_00102942 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258424 predicted 900
2 SASI_Rn02_00258425 predicted 1199
3 SASI_Rn02_00258426 predicted 944
4 SASI_Rn02_00258427 predicted 543
5 SASI_Rn02_00258428 predicted 578
6 SASI_Rn02_00258429 predicted 1166
7 SASI_Rn02_00258430 predicted 928
8 SASI_Rn02_00258431 predicted 1574
9 SASI_Rn02_00258432 predicted 950
10 SASI_Rn02_00258433 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303910 predicted 1080
2 SASI_Rn02_00303911 predicted 898
3 SASI_Rn02_00303912 predicted 1204
4 SASI_Rn02_00303913 predicted 908
5 SASI_Rn02_00303914 predicted 542
6 SASI_Rn02_00303915 predicted 510
7 SASI_Rn02_00303916 predicted 1166
8 SASI_Rn02_00303917 predicted 925
9 SASI_Rn02_00303918 predicted 1578
10 SASI_Rn02_00303919 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350114 predicted 730
2 SASI_Mm02_00350115 predicted 930
3 SASI_Mm02_00350116 predicted 1229
4 SASI_Mm02_00350117 predicted 948
5 SASI_Mm02_00350118 predicted 928
6 SASI_Mm02_00350119 predicted 1867
7 SASI_Mm02_00350120 predicted 473
8 SASI_Mm02_00350121 predicted 1246
9 SASI_Mm02_00350122 predicted 886
10 SASI_Mm02_00350123 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183115
VALIDATED
CCDC125 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 125
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.1-943s1c1
Sequence:CCGGCAGCTCAGACATGAGTTGGAACTCGAGTTCCAACTCATGTCTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.1-948s1c1
Sequence:CCGGCAGACATGAGTTGGAAACTCTCTCGAGAGAGTTTCCAACTCATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.1-814s1c1
Sequence:CCGGGAGGAGAGTGGCTTTACAGATCTCGAGATCTGTAAAGCCACTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.1-990s1c1
Sequence:CCGGGCACATAACGGCAGATGCATTCTCGAGAATGCATCTGCCGTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-661s1c1
Sequence:CCGGGACAGGCTAAACTGTGACAATCTCGAGATTGTCACAGTTTAGCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-702s1c1
Sequence:CCGGGAAGTTGAGAACAGAGGAAATCTCGAGATTTCCTCTGTTCTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-729s1c1
Sequence:CCGGGCTAAAGTCTAAGAATGCTGTCTCGAGACAGCATTCTTAGACTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-692s1c1
Sequence:CCGGGAGAGAATCTGAAGTTGAGAACTCGAGTTCTCAACTTCAGATTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-783s1c1
Sequence:CCGGGCTTGATATCAAGGAGCAGAACTCGAGTTCTGCTCCTTGATATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183115.3-1856s1c1
Sequence:CCGGACCACTTGAAGTTAGAATTAACTCGAGTTAATTCTAACTTCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.3-465s1c1
Sequence:CCGGATGAAGTTCCGTGTTCGATTACTCGAGTAATCGAACACGGAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183115
VALIDATED
CCDC125 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 125
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.1-943s1c1
Sequence:CCGGCAGCTCAGACATGAGTTGGAACTCGAGTTCCAACTCATGTCTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.1-948s1c1
Sequence:CCGGCAGACATGAGTTGGAAACTCTCTCGAGAGAGTTTCCAACTCATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.1-814s1c1
Sequence:CCGGGAGGAGAGTGGCTTTACAGATCTCGAGATCTGTAAAGCCACTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.1-990s1c1
Sequence:CCGGGCACATAACGGCAGATGCATTCTCGAGAATGCATCTGCCGTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-661s1c1
Sequence:CCGGGACAGGCTAAACTGTGACAATCTCGAGATTGTCACAGTTTAGCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-702s1c1
Sequence:CCGGGAAGTTGAGAACAGAGGAAATCTCGAGATTTCCTCTGTTCTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-729s1c1
Sequence:CCGGGCTAAAGTCTAAGAATGCTGTCTCGAGACAGCATTCTTAGACTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-692s1c1
Sequence:CCGGGAGAGAATCTGAAGTTGAGAACTCGAGTTCTCAACTTCAGATTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-783s1c1
Sequence:CCGGGCTTGATATCAAGGAGCAGAACTCGAGTTCTGCTCCTTGATATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183115.3-1856s1c1
Sequence:CCGGACCACTTGAAGTTAGAATTAACTCGAGTTAATTCTAACTTCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.3-465s1c1
Sequence:CCGGATGAAGTTCCGTGTTCGATTACTCGAGTAATCGAACACGGAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183115
VALIDATED
CCDC125 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 125
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.1-943s1c1
Sequence:CCGGCAGCTCAGACATGAGTTGGAACTCGAGTTCCAACTCATGTCTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.1-948s1c1
Sequence:CCGGCAGACATGAGTTGGAAACTCTCTCGAGAGAGTTTCCAACTCATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.1-814s1c1
Sequence:CCGGGAGGAGAGTGGCTTTACAGATCTCGAGATCTGTAAAGCCACTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.1-990s1c1
Sequence:CCGGGCACATAACGGCAGATGCATTCTCGAGAATGCATCTGCCGTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-661s1c1
Sequence:CCGGGACAGGCTAAACTGTGACAATCTCGAGATTGTCACAGTTTAGCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-702s1c1
Sequence:CCGGGAAGTTGAGAACAGAGGAAATCTCGAGATTTCCTCTGTTCTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-729s1c1
Sequence:CCGGGCTAAAGTCTAAGAATGCTGTCTCGAGACAGCATTCTTAGACTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-692s1c1
Sequence:CCGGGAGAGAATCTGAAGTTGAGAACTCGAGTTCTCAACTTCAGATTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183115.1-783s1c1
Sequence:CCGGGCTTGATATCAAGGAGCAGAACTCGAGTTCTGCTCCTTGATATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183115.3-1856s1c1
Sequence:CCGGACCACTTGAAGTTAGAATTAACTCGAGTTAATTCTAACTTCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183115.3-465s1c1
Sequence:CCGGATGAAGTTCCGTGTTCGATTACTCGAGTAATCGAACACGGAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176816
CCDC125 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 125
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176816.2-214s1c1
Sequence:CCGGCCTGGTGGGATTTATGAAATACTCGAGTATTTCATAAATCCCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176816.2-2500s1c1
Sequence:CCGGGCAACCAAATCTGCACAGATTCTCGAGAATCTGTGCAGATTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176816.2-351s1c1
Sequence:CCGGCCAGCAAGATACATTCCCTCACTCGAGTGAGGGAATGTATCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176816.3-1556s21c1
Sequence:CCGGTTGCCATCAAGTATCATATTTCTCGAGAAATATGATACTTGATGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176816.3-1350s21c1
Sequence:CCGGACACTGCTTCAAACGAGAATACTCGAGTATTCTCGTTTGAAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176816.3-1238s21c1
Sequence:CCGGAGTCCTCAAGAGGTCCTTAAGCTCGAGCTTAAGGACCTCTTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176816.3-1013s21c1
Sequence:CCGGGATGCTTTCAGAATTGCATTTCTCGAGAAATGCAATTCTGAAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176816.3-2758s21c1
Sequence:CCGGCTTGTCAGGGTAGTAACATTTCTCGAGAAATGTTACTACCCTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176816
CCDC125 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 125
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176816.2-214s1c1
Sequence:CCGGCCTGGTGGGATTTATGAAATACTCGAGTATTTCATAAATCCCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176816.2-2500s1c1
Sequence:CCGGGCAACCAAATCTGCACAGATTCTCGAGAATCTGTGCAGATTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176816.2-351s1c1
Sequence:CCGGCCAGCAAGATACATTCCCTCACTCGAGTGAGGGAATGTATCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176816.3-1556s21c1
Sequence:CCGGTTGCCATCAAGTATCATATTTCTCGAGAAATATGATACTTGATGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176816.3-1350s21c1
Sequence:CCGGACACTGCTTCAAACGAGAATACTCGAGTATTCTCGTTTGAAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176816.3-1238s21c1
Sequence:CCGGAGTCCTCAAGAGGTCCTTAAGCTCGAGCTTAAGGACCTCTTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176816.3-1013s21c1
Sequence:CCGGGATGCTTTCAGAATTGCATTTCTCGAGAAATGCAATTCTGAAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176816.3-2758s21c1
Sequence:CCGGCTTGTCAGGGTAGTAACATTTCTCGAGAAATGTTACTACCCTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176816
CCDC125 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 125
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176816.2-214s1c1
Sequence:CCGGCCTGGTGGGATTTATGAAATACTCGAGTATTTCATAAATCCCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176816.2-2500s1c1
Sequence:CCGGGCAACCAAATCTGCACAGATTCTCGAGAATCTGTGCAGATTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176816.2-351s1c1
Sequence:CCGGCCAGCAAGATACATTCCCTCACTCGAGTGAGGGAATGTATCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176816.3-1556s21c1
Sequence:CCGGTTGCCATCAAGTATCATATTTCTCGAGAAATATGATACTTGATGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176816.3-1350s21c1
Sequence:CCGGACACTGCTTCAAACGAGAATACTCGAGTATTCTCGTTTGAAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176816.3-1238s21c1
Sequence:CCGGAGTCCTCAAGAGGTCCTTAAGCTCGAGCTTAAGGACCTCTTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176816.3-1013s21c1
Sequence:CCGGGATGCTTTCAGAATTGCATTTCTCGAGAAATGCAATTCTGAAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176816.3-2758s21c1
Sequence:CCGGCTTGTCAGGGTAGTAACATTTCTCGAGAAATGTTACTACCCTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks