EMAIL THIS PAGE TO A FRIEND

CCDC126

coiled-coil domain containing 126

149 Gene Product Result for
UniProtKB ID: Q96EE4, A8K1J6, Q6UWP1, Q75MQ6
Gene ID:
Mouse(57895) coiled-coil domain containing 126
Rat(500117) coiled-coil domain containing 126
Zebrafish(751690) coiled-coil domain containing 126
dog(100688561) coiled-coil domain containing 126
cow(782956) coiled-coil domain containing 126
domestic cat(101091523) coiled-coil domain containing 126
chicken(420619) coiled-coil domain containing 126
sheep(101110932) coiled-coil domain containing 126
domestic guinea pig(100721515) coiled-coil domain containing 126
naked mole-rat(101723889) coiled-coil domain containing 126
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138771 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175098 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175098 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175098 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138771 Rosetta Predictions human pricing
NM_001109232 Rosetta Predictions rat pricing
NM_175098 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183933 predicted 912
2 SASI_Hs01_00183934 predicted 805
3 SASI_Hs01_00183935 predicted 1162
4 SASI_Hs01_00183936 predicted 1087
5 SASI_Hs01_00183937 predicted 1122
6 SASI_Hs01_00183938 predicted 1285
7 SASI_Hs01_00183939 predicted 1105
8 SASI_Hs01_00183940 predicted 702
9 SASI_Hs01_00183941 predicted 1244
10 SASI_Hs02_00363886 predicted 1005
11 SASI_Hs01_00183932 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246384 predicted 901
2 SASI_Rn02_00246385 predicted 748
3 SASI_Rn02_00246386 predicted 820
4 SASI_Rn02_00246387 predicted 960
5 SASI_Rn02_00246388 predicted 861
6 SASI_Rn02_00246389 predicted 806
7 SASI_Rn02_00246390 predicted 749
8 SASI_Rn02_00246391 predicted 611
9 SASI_Rn02_00246392 predicted 554
10 SASI_Rn02_00246393 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068894 predicted 823
2 SASI_Mm01_00068895 predicted 414
3 SASI_Mm01_00068896 predicted 773
4 SASI_Mm01_00068897 predicted 992
5 SASI_Mm01_00068898 predicted 523
6 SASI_Mm02_00345692 predicted 415
7 SASI_Mm01_00068899 predicted 353
8 SASI_Mm01_00068901 predicted 872
9 SASI_Mm01_00068902 predicted 958
10 SASI_Mm01_00068903 predicted 876
11 SASI_Mm01_00068900 predicted 588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138771
CCDC126 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 126
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138771.3-854s21c1
Sequence:CCGGACGAATGTCTCGGGCAGTATCCTCGAGGATACTGCCCGAGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138771.3-1304s21c1
Sequence:CCGGACTGTTAGACTACGGCTATTTCTCGAGAAATAGCCGTAGTCTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138771.3-717s21c1
Sequence:CCGGCTGTCCTTCTGGATGACATTTCTCGAGAAATGTCATCCAGAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-560s1c1
Sequence:CCGGCGTGAGCAAATACTAGACTTACTCGAGTAAGTCTAGTATTTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-457s1c1
Sequence:CCGGCCAGAAATTGAGTTTACTGTTCTCGAGAACAGTAAACTCAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-721s1c1
Sequence:CCGGGCTGGAGAACAAAGTTGACTACTCGAGTAGTCAACTTTGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-774s1c1
Sequence:CCGGCCAATGGTACTAGTGGGAATTCTCGAGAATTCCCACTAGTACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-653s1c1
Sequence:CCGGGCAGGATATGCGGATCTGAAACTCGAGTTTCAGATCCGCATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138771
CCDC126 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 126
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138771.3-854s21c1
Sequence:CCGGACGAATGTCTCGGGCAGTATCCTCGAGGATACTGCCCGAGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138771.3-1304s21c1
Sequence:CCGGACTGTTAGACTACGGCTATTTCTCGAGAAATAGCCGTAGTCTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138771.3-717s21c1
Sequence:CCGGCTGTCCTTCTGGATGACATTTCTCGAGAAATGTCATCCAGAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-560s1c1
Sequence:CCGGCGTGAGCAAATACTAGACTTACTCGAGTAAGTCTAGTATTTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-457s1c1
Sequence:CCGGCCAGAAATTGAGTTTACTGTTCTCGAGAACAGTAAACTCAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-721s1c1
Sequence:CCGGGCTGGAGAACAAAGTTGACTACTCGAGTAGTCAACTTTGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-774s1c1
Sequence:CCGGCCAATGGTACTAGTGGGAATTCTCGAGAATTCCCACTAGTACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-653s1c1
Sequence:CCGGGCAGGATATGCGGATCTGAAACTCGAGTTTCAGATCCGCATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138771
CCDC126 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 126
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138771.3-854s21c1
Sequence:CCGGACGAATGTCTCGGGCAGTATCCTCGAGGATACTGCCCGAGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138771.3-1304s21c1
Sequence:CCGGACTGTTAGACTACGGCTATTTCTCGAGAAATAGCCGTAGTCTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138771.3-717s21c1
Sequence:CCGGCTGTCCTTCTGGATGACATTTCTCGAGAAATGTCATCCAGAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-560s1c1
Sequence:CCGGCGTGAGCAAATACTAGACTTACTCGAGTAAGTCTAGTATTTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-457s1c1
Sequence:CCGGCCAGAAATTGAGTTTACTGTTCTCGAGAACAGTAAACTCAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-721s1c1
Sequence:CCGGGCTGGAGAACAAAGTTGACTACTCGAGTAGTCAACTTTGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-774s1c1
Sequence:CCGGCCAATGGTACTAGTGGGAATTCTCGAGAATTCCCACTAGTACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138771.2-653s1c1
Sequence:CCGGGCAGGATATGCGGATCTGAAACTCGAGTTTCAGATCCGCATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175098
CCDC126 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 126
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175098.2-825s1c1
Sequence:CCGGGCTGGATTCATAGGATGTTAACTCGAGTTAACATCCTATGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175098.2-358s1c1
Sequence:CCGGTGATGCTACTTCACTACACTTCTCGAGAAGTGTAGTGAAGTAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175098.2-579s1c1
Sequence:CCGGGAGAGCAAAGTCGACTATATTCTCGAGAATATAGTCGACTTTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175098.2-516s1c1
Sequence:CCGGGCTGATCTGAAGAGAACGATTCTCGAGAATCGTTCTCTTCAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175098.2-414s1c1
Sequence:CCGGCGTGAGCAAATCCTAGATTTACTCGAGTAAATCTAGGATTTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175098
CCDC126 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 126
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175098.2-825s1c1
Sequence:CCGGGCTGGATTCATAGGATGTTAACTCGAGTTAACATCCTATGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175098.2-358s1c1
Sequence:CCGGTGATGCTACTTCACTACACTTCTCGAGAAGTGTAGTGAAGTAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175098.2-579s1c1
Sequence:CCGGGAGAGCAAAGTCGACTATATTCTCGAGAATATAGTCGACTTTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175098.2-516s1c1
Sequence:CCGGGCTGATCTGAAGAGAACGATTCTCGAGAATCGTTCTCTTCAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175098.2-414s1c1
Sequence:CCGGCGTGAGCAAATCCTAGATTTACTCGAGTAAATCTAGGATTTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175098
CCDC126 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 126
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175098.2-825s1c1
Sequence:CCGGGCTGGATTCATAGGATGTTAACTCGAGTTAACATCCTATGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175098.2-358s1c1
Sequence:CCGGTGATGCTACTTCACTACACTTCTCGAGAAGTGTAGTGAAGTAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175098.2-579s1c1
Sequence:CCGGGAGAGCAAAGTCGACTATATTCTCGAGAATATAGTCGACTTTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175098.2-516s1c1
Sequence:CCGGGCTGATCTGAAGAGAACGATTCTCGAGAATCGTTCTCTTCAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175098.2-414s1c1
Sequence:CCGGCGTGAGCAAATCCTAGATTTACTCGAGTAAATCTAGGATTTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks