EMAIL THIS PAGE TO A FRIEND

CCDC129

coiled-coil domain containing 129

66 Gene Product Result for
UniProtKB ID: Q6ZRS4, A2RU17, B3KTI9, B4DHB0, B4E2R1, F5H3V5
Gene ID:
Mouse(232016) coiled-coil domain containing 129
Rat(500139) coiled-coil domain containing 129
Zebrafish(100334805) coiled-coil domain containing 129
chicken(101751288) coiled-coil domain containing 129
chicken(101668376) coiled-coil domain containing 129
dog(482388) coiled-coil domain containing 129
domestic cat(101095483) coiled-coil domain containing 129
Horse(100055209) coiled-coil domain containing 129
cow(616862) coiled-coil domain containing 129
sheep(101109875) coiled-coil domain containing 129
Domestic Rabbit(100338904) coiled-coil domain containing 129
domestic guinea pig(100725380) coiled-coil domain containing 129
naked mole-rat(101715282) coiled-coil domain containing 129
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194300 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127541 MISSION® esiRNA esiRNA human CCDC129 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194300 Rosetta Predictions human pricing
XM_001061304 Rosetta Predictions rat pricing
XM_575491 Rosetta Predictions rat pricing
NM_001081665 Rosetta Predictions mouse pricing
XM_144699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210623 predicted 1360
2 SASI_Hs02_00371437 predicted 1734
3 SASI_Hs02_00371438 predicted 1225
4 SASI_Hs01_00210625 predicted 1518
5 SASI_Hs02_00371439 predicted 3327
6 SASI_Hs02_00371440 predicted 2054
7 SASI_Hs01_00210627 predicted 1580
8 SASI_Hs02_00371441 predicted 1792
9 SASI_Hs01_00210630 predicted 3044
10 SASI_Hs01_00210631 predicted 3202
11 SASI_Hs01_00210624 predicted 2812
12 SASI_Hs01_00210626 predicted 1297
13 SASI_Hs01_00210628 predicted 2849
14 SASI_Hs01_00210629 predicted 2349
15 SASI_Hs01_00210632 predicted 3319
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299563 predicted 2081
2 SASI_Rn02_00299564 predicted 2069
3 SASI_Rn02_00299565 predicted 896
4 SASI_Rn02_00299566 predicted 1270
5 SASI_Rn02_00299567 predicted 1324
6 SASI_Rn02_00299568 predicted 1232
7 SASI_Rn02_00299569 predicted 1463
8 SASI_Rn02_00299570 predicted 1672
9 SASI_Rn02_00299571 predicted 517
10 SASI_Rn02_00299572 predicted 1941
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403752 predicted 247
2 SASI_Rn02_00403753 predicted 895
3 SASI_Rn02_00403754 predicted 1271
4 SASI_Rn02_00403755 predicted 1106
5 SASI_Rn02_00403756 predicted 1318
6 SASI_Rn02_00403757 predicted 1525
7 SASI_Rn02_00403758 predicted 701
8 SASI_Rn02_00403759 predicted 1236
9 SASI_Rn02_00403760 predicted 1462
10 SASI_Rn02_00403761 predicted 1665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298900 predicted 2322
2 SASI_Mm02_00298901 predicted 1010
3 SASI_Mm02_00298902 predicted 1304
4 SASI_Mm02_00298903 predicted 2887
5 SASI_Mm02_00298904 predicted 2022
6 SASI_Mm02_00298905 predicted 1833
7 SASI_Mm02_00298906 predicted 2224
8 SASI_Mm02_00298907 predicted 1517
9 SASI_Mm02_00298908 predicted 611
10 SASI_Mm02_00298909 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_144699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219377 predicted 1997
2 SASI_Mm01_00219378 predicted 985
3 SASI_Mm01_00219379 predicted 806
4 SASI_Mm01_00219380 predicted 2557
5 SASI_Mm01_00219381 predicted 1701
6 SASI_Mm01_00219382 predicted 1509
7 SASI_Mm01_00219383 predicted 1905
8 SASI_Mm01_00219384 predicted 1934
9 SASI_Mm01_00219385 predicted 1144
10 SASI_Mm01_00219386 predicted 911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194300
CCDC129 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 129
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194300.2-1954s21c1
Sequence:CCGGTGTGATGATTTGCTACCTTATCTCGAGATAAGGTAGCAAATCATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194300.2-3517s21c1
Sequence:CCGGGCCCAGTTCATGACGACTTTGCTCGAGCAAAGTCGTCATGAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194300.2-4350s21c1
Sequence:CCGGCAACAGTGACTAAATAGTATACTCGAGTATACTATTTAGTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194300.2-4223s21c1
Sequence:CCGGCAACCCATTGTCAGCTATATCCTCGAGGATATAGCTGACAATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194300.2-2460s21c1
Sequence:CCGGAGCGAATGCCTTGGAACAAAGCTCGAGCTTTGTTCCAAGGCATTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194300.1-3171s1c1
Sequence:CCGGCCAAAGTTTCCGGGAGTATTTCTCGAGAAATACTCCCGGAAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194300.1-2347s1c1
Sequence:CCGGCCTGGAAATGATCATACTCAACTCGAGTTGAGTATGATCATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194300.1-4064s1c1
Sequence:CCGGGCCTTTCTCCAAAGATGATTTCTCGAGAAATCATCTTTGGAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194300.1-2014s1c1
Sequence:CCGGGAAGTGAATGCCTTGGAACAACTCGAGTTGTTCCAAGGCATTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194300
CCDC129 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 129
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194300.2-1954s21c1
Sequence:CCGGTGTGATGATTTGCTACCTTATCTCGAGATAAGGTAGCAAATCATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194300.2-3517s21c1
Sequence:CCGGGCCCAGTTCATGACGACTTTGCTCGAGCAAAGTCGTCATGAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194300.2-4350s21c1
Sequence:CCGGCAACAGTGACTAAATAGTATACTCGAGTATACTATTTAGTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194300.2-4223s21c1
Sequence:CCGGCAACCCATTGTCAGCTATATCCTCGAGGATATAGCTGACAATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194300.2-2460s21c1
Sequence:CCGGAGCGAATGCCTTGGAACAAAGCTCGAGCTTTGTTCCAAGGCATTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194300.1-3171s1c1
Sequence:CCGGCCAAAGTTTCCGGGAGTATTTCTCGAGAAATACTCCCGGAAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194300.1-2347s1c1
Sequence:CCGGCCTGGAAATGATCATACTCAACTCGAGTTGAGTATGATCATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194300.1-4064s1c1
Sequence:CCGGGCCTTTCTCCAAAGATGATTTCTCGAGAAATCATCTTTGGAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194300.1-2014s1c1
Sequence:CCGGGAAGTGAATGCCTTGGAACAACTCGAGTTGTTCCAAGGCATTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194300
CCDC129 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 129
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194300.2-1954s21c1
Sequence:CCGGTGTGATGATTTGCTACCTTATCTCGAGATAAGGTAGCAAATCATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194300.2-3517s21c1
Sequence:CCGGGCCCAGTTCATGACGACTTTGCTCGAGCAAAGTCGTCATGAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194300.2-4350s21c1
Sequence:CCGGCAACAGTGACTAAATAGTATACTCGAGTATACTATTTAGTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194300.2-4223s21c1
Sequence:CCGGCAACCCATTGTCAGCTATATCCTCGAGGATATAGCTGACAATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194300.2-2460s21c1
Sequence:CCGGAGCGAATGCCTTGGAACAAAGCTCGAGCTTTGTTCCAAGGCATTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194300.1-3171s1c1
Sequence:CCGGCCAAAGTTTCCGGGAGTATTTCTCGAGAAATACTCCCGGAAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194300.1-2347s1c1
Sequence:CCGGCCTGGAAATGATCATACTCAACTCGAGTTGAGTATGATCATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194300.1-4064s1c1
Sequence:CCGGGCCTTTCTCCAAAGATGATTTCTCGAGAAATCATCTTTGGAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194300.1-2014s1c1
Sequence:CCGGGAAGTGAATGCCTTGGAACAACTCGAGTTGTTCCAAGGCATTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081665
CCDC129 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 129
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-447s21c1
Sequence:CCGGCTAGTTTCAACTCGTGTTATTCTCGAGAATAACACGAGTTGAAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-2874s21c1
Sequence:CCGGTACCTGAACACTGCGACAATCCTCGAGGATTGTCGCAGTGTTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-2012s21c1
Sequence:CCGGAGAGGAGCCATGCCCTATAAACTCGAGTTTATAGGGCATGGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-357s21c1
Sequence:CCGGTGCACGAACAAGGAATCATTCCTCGAGGAATGATTCCTTGTTCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-2177s21c1
Sequence:CCGGGCAGACCTAGGGACCTATAATCTCGAGATTATAGGTCCCTAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081665
CCDC129 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 129
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-447s21c1
Sequence:CCGGCTAGTTTCAACTCGTGTTATTCTCGAGAATAACACGAGTTGAAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-2874s21c1
Sequence:CCGGTACCTGAACACTGCGACAATCCTCGAGGATTGTCGCAGTGTTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-2012s21c1
Sequence:CCGGAGAGGAGCCATGCCCTATAAACTCGAGTTTATAGGGCATGGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-357s21c1
Sequence:CCGGTGCACGAACAAGGAATCATTCCTCGAGGAATGATTCCTTGTTCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-2177s21c1
Sequence:CCGGGCAGACCTAGGGACCTATAATCTCGAGATTATAGGTCCCTAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081665
CCDC129 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 129
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-447s21c1
Sequence:CCGGCTAGTTTCAACTCGTGTTATTCTCGAGAATAACACGAGTTGAAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-2874s21c1
Sequence:CCGGTACCTGAACACTGCGACAATCCTCGAGGATTGTCGCAGTGTTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-2012s21c1
Sequence:CCGGAGAGGAGCCATGCCCTATAAACTCGAGTTTATAGGGCATGGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-357s21c1
Sequence:CCGGTGCACGAACAAGGAATCATTCCTCGAGGAATGATTCCTTGTTCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081665.1-2177s21c1
Sequence:CCGGGCAGACCTAGGGACCTATAATCTCGAGATTATAGGTCCCTAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks