EMAIL THIS PAGE TO A FRIEND

CCDC12

coiled-coil domain containing 12

52 Gene Product Result for
UniProtKB ID: Q8WUD4, Q8N8I4
Gene ID:
Mouse(72654) coiled-coil domain containing 12
Rat(363151) coiled-coil domain containing 12
Zebrafish(793027) coiled-coil domain containing 12
cow(617519) coiled-coil domain containing 12
domestic cat(101096212) coiled-coil domain containing 12
dog(484785) coiled-coil domain containing 12
chicken(420402) coiled-coil domain containing 12
sheep(101115164) coiled-coil domain containing 12
domestic guinea pig(100718619) coiled-coil domain containing 12
naked mole-rat(101713370) coiled-coil domain containing 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144716 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028312 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028312 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028312 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU010301 MISSION® esiRNA esiRNA targeting mouse Ccdc12 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144716 Rosetta Predictions human pricing
NM_001108783 Rosetta Predictions rat pricing
NM_028312 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014613 predicted 421
2 SASI_Hs01_00014614 predicted 404
3 SASI_Hs01_00014615 predicted 412
4 SASI_Hs01_00014616 predicted 469
5 SASI_Hs01_00014617 predicted 428
6 SASI_Hs01_00014618 predicted 235
7 SASI_Hs01_00014619 predicted 357
8 SASI_Hs01_00014620 predicted 323
9 SASI_Hs01_00014621 predicted 411
10 SASI_Hs01_00014622 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242035 predicted 539
2 SASI_Rn02_00242036 predicted 539
3 SASI_Rn02_00242037 predicted 403
4 SASI_Rn02_00242038 predicted 416
5 SASI_Rn02_00242039 predicted 540
6 SASI_Rn02_00242040 predicted 334
7 SASI_Rn02_00242041 predicted 387
8 SASI_Rn02_00242042 predicted 543
9 SASI_Rn02_00242043 predicted 384
10 SASI_Rn02_00242044 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119581 predicted 222
2 SASI_Mm01_00119582 predicted 231
3 SASI_Mm01_00119583 predicted 547
4 SASI_Mm01_00119584 predicted 534
5 SASI_Mm01_00119586 predicted 466
6 SASI_Mm02_00333669 predicted 554
7 SASI_Mm01_00119587 predicted 526
8 SASI_Mm02_00333670 predicted 345
9 SASI_Mm01_00119588 predicted 422
10 SASI_Mm02_00333671 predicted 202
11 SASI_Mm01_00119585 predicted 392
12 SASI_Mm01_00119589 predicted 409
13 SASI_Mm01_00119590 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144716
VALIDATED
CCDC12 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 12
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144716.3-282s21c1
Sequence:CCGGACCGGTTGCAGTGGAGGAGAACTCGAGTTCTCCTCCACTGCAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-228s21c1
Sequence:CCGGGAACTATGTCCCGGAGGATGACTCGAGTCATCCTCCGGGACATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-624s21c1
Sequence:CCGGGCTTGCCATCACCTCCAGTTTCTCGAGAAACTGGAGGTGATGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-159s21c1
Sequence:CCGGGGAGCCAAAGACCAAGCATCTCTCGAGAGATGCTTGGTCTTTGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144716.3-461s21c1
Sequence:CCGGTGATCCGTGAAAGGCTGAAAGCTCGAGCTTTCAGCCTTTCACGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-201s21c1
Sequence:CCGGCGAGAAGCACAGGGAACTTAGCTCGAGCTAAGTTCCCTGTGCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144716.3-509s21c1
Sequence:CCGGTGGATGCTGCCACCGAACAAACTCGAGTTTGTTCGGTGGCAGCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-664s21c1
Sequence:CCGGCCTGCCCATCAAGTCTGAAACCTCGAGGTTTCAGACTTGATGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144716.3-384s21c1
Sequence:CCGGTGACTGGGACCTCAAGAGAGACTCGAGTCTCTCTTGAGGTCCCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144716.1-696s1c1
Sequence:CCGGCCATTCTGAATGGAGGCAGAACTCGAGTTCTGCCTCCATTCAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144716.1-194s1c1
Sequence:CCGGCGGAACTATGTCCCGGAGGATCTCGAGATCCTCCGGGACATAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144716.1-377s1c1
Sequence:CCGGGCCAAGAAGCTGGAGAAACTACTCGAGTAGTTTCTCCAGCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144716.1-178s1c1
Sequence:CCGGCAGGGAACTTAGGCTGCGGAACTCGAGTTCCGCAGCCTAAGTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144716.1-428s1c1
Sequence:CCGGCTGATCCGTGAAAGGCTGAAACTCGAGTTTCAGCCTTTCACGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144716
VALIDATED
CCDC12 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 12
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144716.3-282s21c1
Sequence:CCGGACCGGTTGCAGTGGAGGAGAACTCGAGTTCTCCTCCACTGCAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-228s21c1
Sequence:CCGGGAACTATGTCCCGGAGGATGACTCGAGTCATCCTCCGGGACATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-624s21c1
Sequence:CCGGGCTTGCCATCACCTCCAGTTTCTCGAGAAACTGGAGGTGATGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-159s21c1
Sequence:CCGGGGAGCCAAAGACCAAGCATCTCTCGAGAGATGCTTGGTCTTTGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144716.3-461s21c1
Sequence:CCGGTGATCCGTGAAAGGCTGAAAGCTCGAGCTTTCAGCCTTTCACGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-201s21c1
Sequence:CCGGCGAGAAGCACAGGGAACTTAGCTCGAGCTAAGTTCCCTGTGCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144716.3-509s21c1
Sequence:CCGGTGGATGCTGCCACCGAACAAACTCGAGTTTGTTCGGTGGCAGCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-664s21c1
Sequence:CCGGCCTGCCCATCAAGTCTGAAACCTCGAGGTTTCAGACTTGATGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144716.3-384s21c1
Sequence:CCGGTGACTGGGACCTCAAGAGAGACTCGAGTCTCTCTTGAGGTCCCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144716.1-696s1c1
Sequence:CCGGCCATTCTGAATGGAGGCAGAACTCGAGTTCTGCCTCCATTCAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144716.1-194s1c1
Sequence:CCGGCGGAACTATGTCCCGGAGGATCTCGAGATCCTCCGGGACATAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144716.1-377s1c1
Sequence:CCGGGCCAAGAAGCTGGAGAAACTACTCGAGTAGTTTCTCCAGCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144716.1-178s1c1
Sequence:CCGGCAGGGAACTTAGGCTGCGGAACTCGAGTTCCGCAGCCTAAGTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144716.1-428s1c1
Sequence:CCGGCTGATCCGTGAAAGGCTGAAACTCGAGTTTCAGCCTTTCACGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144716
VALIDATED
CCDC12 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 12
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144716.3-282s21c1
Sequence:CCGGACCGGTTGCAGTGGAGGAGAACTCGAGTTCTCCTCCACTGCAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-228s21c1
Sequence:CCGGGAACTATGTCCCGGAGGATGACTCGAGTCATCCTCCGGGACATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-624s21c1
Sequence:CCGGGCTTGCCATCACCTCCAGTTTCTCGAGAAACTGGAGGTGATGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-159s21c1
Sequence:CCGGGGAGCCAAAGACCAAGCATCTCTCGAGAGATGCTTGGTCTTTGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144716.3-461s21c1
Sequence:CCGGTGATCCGTGAAAGGCTGAAAGCTCGAGCTTTCAGCCTTTCACGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-201s21c1
Sequence:CCGGCGAGAAGCACAGGGAACTTAGCTCGAGCTAAGTTCCCTGTGCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144716.3-509s21c1
Sequence:CCGGTGGATGCTGCCACCGAACAAACTCGAGTTTGTTCGGTGGCAGCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144716.3-664s21c1
Sequence:CCGGCCTGCCCATCAAGTCTGAAACCTCGAGGTTTCAGACTTGATGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144716.3-384s21c1
Sequence:CCGGTGACTGGGACCTCAAGAGAGACTCGAGTCTCTCTTGAGGTCCCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144716.1-696s1c1
Sequence:CCGGCCATTCTGAATGGAGGCAGAACTCGAGTTCTGCCTCCATTCAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144716.1-194s1c1
Sequence:CCGGCGGAACTATGTCCCGGAGGATCTCGAGATCCTCCGGGACATAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144716.1-377s1c1
Sequence:CCGGGCCAAGAAGCTGGAGAAACTACTCGAGTAGTTTCTCCAGCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144716.1-178s1c1
Sequence:CCGGCAGGGAACTTAGGCTGCGGAACTCGAGTTCCGCAGCCTAAGTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144716.1-428s1c1
Sequence:CCGGCTGATCCGTGAAAGGCTGAAACTCGAGTTTCAGCCTTTCACGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028312
VALIDATED
CCDC12 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028312.1-583s1c1
Sequence:CCGGTGATCTGTTCAGCACACACATCTCGAGATGTGTGTGCTGAACAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028312.1-422s1c1
Sequence:CCGGGCCAAGAAGCTAGAGAAGCTACTCGAGTAGCTTCTCTAGCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028312.1-391s1c1
Sequence:CCGGGAAACCTGATTGGGATCTCAACTCGAGTTGAGATCCCAATCAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028312.1-110s1c1
Sequence:CCGGCGGCGGAAAGAACGGCTGAAGCTCGAGCTTCAGCCGTTCTTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028312.1-88s1c1
Sequence:CCGGCCGCCTAGAGGAAGAGGCGCTCTCGAGAGCGCCTCTTCCTCTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028312
VALIDATED
CCDC12 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028312.1-583s1c1
Sequence:CCGGTGATCTGTTCAGCACACACATCTCGAGATGTGTGTGCTGAACAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028312.1-422s1c1
Sequence:CCGGGCCAAGAAGCTAGAGAAGCTACTCGAGTAGCTTCTCTAGCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028312.1-391s1c1
Sequence:CCGGGAAACCTGATTGGGATCTCAACTCGAGTTGAGATCCCAATCAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028312.1-110s1c1
Sequence:CCGGCGGCGGAAAGAACGGCTGAAGCTCGAGCTTCAGCCGTTCTTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028312.1-88s1c1
Sequence:CCGGCCGCCTAGAGGAAGAGGCGCTCTCGAGAGCGCCTCTTCCTCTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028312
VALIDATED
CCDC12 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028312.1-583s1c1
Sequence:CCGGTGATCTGTTCAGCACACACATCTCGAGATGTGTGTGCTGAACAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028312.1-422s1c1
Sequence:CCGGGCCAAGAAGCTAGAGAAGCTACTCGAGTAGCTTCTCTAGCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028312.1-391s1c1
Sequence:CCGGGAAACCTGATTGGGATCTCAACTCGAGTTGAGATCCCAATCAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028312.1-110s1c1
Sequence:CCGGCGGCGGAAAGAACGGCTGAAGCTCGAGCTTCAGCCGTTCTTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028312.1-88s1c1
Sequence:CCGGCCGCCTAGAGGAAGAGGCGCTCTCGAGAGCGCCTCTTCCTCTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks