EMAIL THIS PAGE TO A FRIEND

CCDC130

coiled-coil domain containing 130

52 Gene Product Result for
UniProtKB ID: P13994, Q9BQ72
Gene ID:
Mouse(67736) coiled-coil domain containing 130
Rat(304656) coiled-coil domain containing 130
Zebrafish(402887) coiled-coil domain containing 130
cow(614791) coiled-coil domain containing 130
domestic cat(101088988) coiled-coil domain containing 130
dog(484915) coiled-coil domain containing 130
sheep(101102978) coiled-coil domain containing 130
domestic guinea pig(100725730) coiled-coil domain containing 130
naked mole-rat(101697263) coiled-coil domain containing 130
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030818 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030818 Rosetta Predictions human pricing
NM_001037644 Rosetta Predictions rat pricing
NM_026350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358402 predicted 412
2 SASI_Hs01_00089479 predicted 353
3 SASI_Hs01_00089481 predicted 462
4 SASI_Hs01_00089482 predicted 547
5 SASI_Hs01_00089484 predicted 1051
6 SASI_Hs01_00089485 predicted 228
7 SASI_Hs01_00089486 predicted 929
8 SASI_Hs01_00089487 predicted 366
9 SASI_Hs01_00089488 predicted 1370
10 SASI_Hs02_00358403 predicted 746
11 SASI_Hs01_00089480 predicted 480
12 SASI_Hs01_00089483 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034998 predicted 352
2 SASI_Rn01_00035000 predicted 337
3 SASI_Rn01_00035001 predicted 1144
4 SASI_Rn01_00035002 predicted 655
5 SASI_Rn02_00204514 predicted 471
6 SASI_Rn01_00035003 predicted 520
7 SASI_Rn01_00035004 predicted 1237
8 SASI_Rn02_00204515 predicted 225
9 SASI_Rn02_00204516 predicted 1249
10 SASI_Rn01_00035005 predicted 320
11 SASI_Rn01_00034999 predicted 747
12 SASI_Rn01_00035006 predicted 652
13 SASI_Rn01_00035007 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118113 predicted 392
2 SASI_Mm01_00118114 predicted 476
3 SASI_Mm01_00118115 predicted 1137
4 SASI_Mm01_00118117 predicted 1487
5 SASI_Mm02_00330070 predicted 1286
6 SASI_Mm01_00118118 predicted 1452
7 SASI_Mm01_00118119 predicted 466
8 SASI_Mm02_00330071 predicted 783
9 SASI_Mm01_00118120 predicted 493
10 SASI_Mm02_00330072 predicted 1402
11 SASI_Mm01_00118116 predicted 1508
12 SASI_Mm01_00118121 predicted 517
13 SASI_Mm01_00118122 predicted 1000
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030818
CCDC130 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 130
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000156870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030818.2-619s1c1
Sequence:CCGGGCATGAGAAGAAGCAGAAGCTCTCGAGAGCTTCTGCTTCTTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030818.2-466s1c1
Sequence:CCGGGATCTACAGGTTCCGGATGAACTCGAGTTCATCCGGAACCTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030818.2-934s1c1
Sequence:CCGGCGAGGACAAGCAGAAACTCAACTCGAGTTGAGTTTCTGCTTGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030818.2-496s1c1
Sequence:CCGGCTGTGTCAACTACATCGAGATCTCGAGATCTCGATGTAGTTGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030818
CCDC130 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 130
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000156870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030818.2-619s1c1
Sequence:CCGGGCATGAGAAGAAGCAGAAGCTCTCGAGAGCTTCTGCTTCTTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030818.2-466s1c1
Sequence:CCGGGATCTACAGGTTCCGGATGAACTCGAGTTCATCCGGAACCTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030818.2-934s1c1
Sequence:CCGGCGAGGACAAGCAGAAACTCAACTCGAGTTGAGTTTCTGCTTGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030818.2-496s1c1
Sequence:CCGGCTGTGTCAACTACATCGAGATCTCGAGATCTCGATGTAGTTGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030818
CCDC130 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 130
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000156870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030818.2-619s1c1
Sequence:CCGGGCATGAGAAGAAGCAGAAGCTCTCGAGAGCTTCTGCTTCTTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030818.2-466s1c1
Sequence:CCGGGATCTACAGGTTCCGGATGAACTCGAGTTCATCCGGAACCTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030818.2-934s1c1
Sequence:CCGGCGAGGACAAGCAGAAACTCAACTCGAGTTGAGTTTCTGCTTGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030818.2-496s1c1
Sequence:CCGGCTGTGTCAACTACATCGAGATCTCGAGATCTCGATGTAGTTGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026350
CCDC130 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 130
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000180850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026350.1-486s1c1
Sequence:CCGGGCAACTATTACACGACTCCAACTCGAGTTGGAGTCGTGTAATAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026350.1-1190s1c1
Sequence:CCGGGACAACTCCTTGTCAGAAGAACTCGAGTTCTTCTGACAAGGAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026350.1-961s1c1
Sequence:CCGGCCTGGACTCTTATGAGGACAACTCGAGTTGTCCTCATAAGAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026350.1-406s1c1
Sequence:CCGGGCCATACAACATCTGGTGTGACTCGAGTCACACCAGATGTTGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026350
CCDC130 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 130
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000180850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026350.1-486s1c1
Sequence:CCGGGCAACTATTACACGACTCCAACTCGAGTTGGAGTCGTGTAATAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026350.1-1190s1c1
Sequence:CCGGGACAACTCCTTGTCAGAAGAACTCGAGTTCTTCTGACAAGGAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026350.1-961s1c1
Sequence:CCGGCCTGGACTCTTATGAGGACAACTCGAGTTGTCCTCATAAGAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026350.1-406s1c1
Sequence:CCGGGCCATACAACATCTGGTGTGACTCGAGTCACACCAGATGTTGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026350
CCDC130 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 130
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000180850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026350.1-486s1c1
Sequence:CCGGGCAACTATTACACGACTCCAACTCGAGTTGGAGTCGTGTAATAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026350.1-1190s1c1
Sequence:CCGGGACAACTCCTTGTCAGAAGAACTCGAGTTCTTCTGACAAGGAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026350.1-961s1c1
Sequence:CCGGCCTGGACTCTTATGAGGACAACTCGAGTTGTCCTCATAAGAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026350.1-406s1c1
Sequence:CCGGGCCATACAACATCTGGTGTGACTCGAGTCACACCAGATGTTGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks