EMAIL THIS PAGE TO A FRIEND

CCDC132

coiled-coil domain containing 132

221 Gene Product Result for
Gene ID:
Mouse(73288) coiled-coil domain containing 132
Rat(312083) coiled-coil domain containing 132
naked mole-rat(101718978) coiled-coil domain containing 132
domestic guinea pig(100718331) coiled-coil domain containing 132
sheep(101112807) coiled-coil domain containing 132
Domestic Rabbit(100353605) coiled-coil domain containing 132
chicken(420560) coiled-coil domain containing 132
cow(535248) coiled-coil domain containing 132
Horse(100051289) coiled-coil domain containing 132
dog(475228) coiled-coil domain containing 132
domestic cat(101093508) coiled-coil domain containing 132
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024553 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017667 Rosetta Predictions human pricing
NM_024553 Rosetta Predictions human pricing
XM_001064458 Rosetta Predictions rat pricing
XM_231428 Rosetta Predictions rat pricing
NM_024260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234886 predicted 278
2 SASI_Hs01_00234887 predicted 550
3 SASI_Hs01_00234888 predicted 267
4 SASI_Hs01_00234889 predicted 257
5 SASI_Hs01_00234890 predicted 386
6 SASI_Hs01_00234891 predicted 721
7 SASI_Hs01_00234892 predicted 701
8 SASI_Hs01_00234893 predicted 396
9 SASI_Hs01_00234894 predicted 681
10 SASI_Hs01_00234895 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214058 predicted 276
2 SASI_Hs01_00214059 predicted 548
3 SASI_Hs01_00214060 predicted 272
4 SASI_Hs01_00214061 predicted 257
5 SASI_Hs01_00214062 predicted 387
6 SASI_Hs01_00214063 predicted 715
7 SASI_Hs01_00214064 predicted 697
8 SASI_Hs01_00214065 predicted 396
9 SASI_Hs01_00214066 predicted 689
10 SASI_Hs01_00214067 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310595 predicted 927
2 SASI_Rn02_00310596 predicted 2591
3 SASI_Rn02_00310597 predicted 2661
4 SASI_Rn02_00310598 predicted 1950
5 SASI_Rn02_00310599 predicted 706
6 SASI_Rn02_00310600 predicted 2883
7 SASI_Rn02_00310601 predicted 898
8 SASI_Rn02_00310602 predicted 3091
9 SASI_Rn02_00310603 predicted 268
10 SASI_Rn02_00310604 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231428 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386784 predicted 926
2 SASI_Rn02_00386785 predicted 2594
3 SASI_Rn02_00386786 predicted 2665
4 SASI_Rn02_00386787 predicted 1952
5 SASI_Rn02_00386788 predicted 704
6 SASI_Rn02_00386789 predicted 2882
7 SASI_Rn02_00386790 predicted 891
8 SASI_Rn02_00386791 predicted 3091
9 SASI_Rn02_00386792 predicted 267
10 SASI_Rn02_00386793 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194729 predicted 2587
2 SASI_Mm01_00194730 predicted 2627
3 SASI_Mm01_00194731 predicted 1192
4 SASI_Mm01_00194732 predicted 2041
5 SASI_Mm01_00194733 predicted 694
6 SASI_Mm01_00194735 predicted 2545
7 SASI_Mm01_00194736 predicted 260
8 SASI_Mm01_00194737 predicted 3060
9 SASI_Mm01_00194738 predicted 2810
10 SASI_Mm02_00327651 predicted 1723
11 SASI_Mm01_00194734 predicted 865
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024553
VALIDATED
CCDC132 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 132
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024553.2-174s1c1
Sequence:CCGGCCTCAAGAAAGCCTCAGTGATCTCGAGATCACTGAGGCTTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024553.2-668s1c1
Sequence:CCGGGCAAAGAACAGATGTACGGTTCTCGAGAACCGTACATCTGTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024553.2-356s1c1
Sequence:CCGGGCTTCCACCTGTTCTCAATTTCTCGAGAAATTGAGAACAGGTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024553.2-723s1c1
Sequence:CCGGGCTATTCAGTTGTGCCTTGAACTCGAGTTCAAGGCACAACTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024553.2-806s1c1
Sequence:CCGGGCAAGATACTTTGGAACAGATCTCGAGATCTGTTCCAAAGTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-387s21c1
Sequence:CCGGGAGGCGTATAGAGACAAATTGCTCGAGCAATTTGTCTCTATACGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-641s21c1
Sequence:CCGGGAAATCTCTGAGAACTATAAACTCGAGTTTATAGTTCTCAGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-314s21c1
Sequence:CCGGTTCTGTGGATTCATTTGATATCTCGAGATATCAAATGAATCCACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-543s21c1
Sequence:CCGGGGGAGAAGACACTTGAATATTCTCGAGAATATTCAAGTGTCTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-272s21c1
Sequence:CCGGAGCTGAACAAGAGCTTATTAACTCGAGTTAATAAGCTCTTGTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-967s21c1
Sequence:CCGGCCATTCACAACACCGTGTTTCCTCGAGGAAACACGGTGTTGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-588s21c1
Sequence:CCGGAGTTTAGGCCTTCTTGCAAATCTCGAGATTTGCAAGAAGGCCTAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-1075s21c1
Sequence:CCGGGTAGTGACTTAATTACTATTCCTCGAGGAATAGTAATTAAGTCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-932s21c1
Sequence:CCGGAGCAATGGATCAACTTCATATCTCGAGATATGAAGTTGATCCATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024553
VALIDATED
CCDC132 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 132
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024553.2-174s1c1
Sequence:CCGGCCTCAAGAAAGCCTCAGTGATCTCGAGATCACTGAGGCTTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024553.2-668s1c1
Sequence:CCGGGCAAAGAACAGATGTACGGTTCTCGAGAACCGTACATCTGTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024553.2-356s1c1
Sequence:CCGGGCTTCCACCTGTTCTCAATTTCTCGAGAAATTGAGAACAGGTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024553.2-723s1c1
Sequence:CCGGGCTATTCAGTTGTGCCTTGAACTCGAGTTCAAGGCACAACTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024553.2-806s1c1
Sequence:CCGGGCAAGATACTTTGGAACAGATCTCGAGATCTGTTCCAAAGTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-387s21c1
Sequence:CCGGGAGGCGTATAGAGACAAATTGCTCGAGCAATTTGTCTCTATACGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-641s21c1
Sequence:CCGGGAAATCTCTGAGAACTATAAACTCGAGTTTATAGTTCTCAGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-314s21c1
Sequence:CCGGTTCTGTGGATTCATTTGATATCTCGAGATATCAAATGAATCCACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-543s21c1
Sequence:CCGGGGGAGAAGACACTTGAATATTCTCGAGAATATTCAAGTGTCTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-272s21c1
Sequence:CCGGAGCTGAACAAGAGCTTATTAACTCGAGTTAATAAGCTCTTGTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-967s21c1
Sequence:CCGGCCATTCACAACACCGTGTTTCCTCGAGGAAACACGGTGTTGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-588s21c1
Sequence:CCGGAGTTTAGGCCTTCTTGCAAATCTCGAGATTTGCAAGAAGGCCTAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-1075s21c1
Sequence:CCGGGTAGTGACTTAATTACTATTCCTCGAGGAATAGTAATTAAGTCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-932s21c1
Sequence:CCGGAGCAATGGATCAACTTCATATCTCGAGATATGAAGTTGATCCATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024553
VALIDATED
CCDC132 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 132
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024553.2-174s1c1
Sequence:CCGGCCTCAAGAAAGCCTCAGTGATCTCGAGATCACTGAGGCTTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024553.2-668s1c1
Sequence:CCGGGCAAAGAACAGATGTACGGTTCTCGAGAACCGTACATCTGTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024553.2-356s1c1
Sequence:CCGGGCTTCCACCTGTTCTCAATTTCTCGAGAAATTGAGAACAGGTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024553.2-723s1c1
Sequence:CCGGGCTATTCAGTTGTGCCTTGAACTCGAGTTCAAGGCACAACTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024553.2-806s1c1
Sequence:CCGGGCAAGATACTTTGGAACAGATCTCGAGATCTGTTCCAAAGTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-387s21c1
Sequence:CCGGGAGGCGTATAGAGACAAATTGCTCGAGCAATTTGTCTCTATACGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-641s21c1
Sequence:CCGGGAAATCTCTGAGAACTATAAACTCGAGTTTATAGTTCTCAGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-314s21c1
Sequence:CCGGTTCTGTGGATTCATTTGATATCTCGAGATATCAAATGAATCCACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-543s21c1
Sequence:CCGGGGGAGAAGACACTTGAATATTCTCGAGAATATTCAAGTGTCTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-272s21c1
Sequence:CCGGAGCTGAACAAGAGCTTATTAACTCGAGTTAATAAGCTCTTGTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-967s21c1
Sequence:CCGGCCATTCACAACACCGTGTTTCCTCGAGGAAACACGGTGTTGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-588s21c1
Sequence:CCGGAGTTTAGGCCTTCTTGCAAATCTCGAGATTTGCAAGAAGGCCTAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-1075s21c1
Sequence:CCGGGTAGTGACTTAATTACTATTCCTCGAGGAATAGTAATTAAGTCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024553.2-932s21c1
Sequence:CCGGAGCAATGGATCAACTTCATATCTCGAGATATGAAGTTGATCCATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024260
VALIDATED
CCDC132 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 132
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024260.2-278s1c1
Sequence:CCGGCGGATCCATTTGATATTGTTACTCGAGTAACAATATCAAATGGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024260.2-1569s1c1
Sequence:CCGGCCCATCAGTTTCACCTAGTAACTCGAGTTACTAGGTGAAACTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024260.4-2050s1c1
Sequence:CCGGCTATTACTTGTATGCCATATACTCGAGTATATGGCATACAAGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024260.4-3365s1c1
Sequence:CCGGGAGGATGAATGTACAGTATTTCTCGAGAAATACTGTACATTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024260.4-2591s1c1
Sequence:CCGGCAGTTTAACAAGCGGTTAAATCTCGAGATTTAACCGCTTGTTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024260.4-956s21c1
Sequence:CCGGGCCATTCACAACACCGTATTTCTCGAGAAATACGGTGTTGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024260.4-282s21c1
Sequence:CCGGATAGCATTGAACAAGTCTATTCTCGAGAATAGACTTGTTCAATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024260.4-1064s21c1
Sequence:CCGGGTGACACCAGACAGCTATATTCTCGAGAATATAGCTGTCTGGTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024260.4-2050s21c1
Sequence:CCGGCTATTACTTGTATGCCATATACTCGAGTATATGGCATACAAGTAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024260.4-3365s21c1
Sequence:CCGGGAGGATGAATGTACAGTATTTCTCGAGAAATACTGTACATTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024260
VALIDATED
CCDC132 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 132
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024260.2-278s1c1
Sequence:CCGGCGGATCCATTTGATATTGTTACTCGAGTAACAATATCAAATGGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024260.2-1569s1c1
Sequence:CCGGCCCATCAGTTTCACCTAGTAACTCGAGTTACTAGGTGAAACTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024260.4-2050s1c1
Sequence:CCGGCTATTACTTGTATGCCATATACTCGAGTATATGGCATACAAGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024260.4-3365s1c1
Sequence:CCGGGAGGATGAATGTACAGTATTTCTCGAGAAATACTGTACATTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024260.4-2591s1c1
Sequence:CCGGCAGTTTAACAAGCGGTTAAATCTCGAGATTTAACCGCTTGTTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024260.4-956s21c1
Sequence:CCGGGCCATTCACAACACCGTATTTCTCGAGAAATACGGTGTTGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024260.4-282s21c1
Sequence:CCGGATAGCATTGAACAAGTCTATTCTCGAGAATAGACTTGTTCAATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024260.4-1064s21c1
Sequence:CCGGGTGACACCAGACAGCTATATTCTCGAGAATATAGCTGTCTGGTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024260.4-2050s21c1
Sequence:CCGGCTATTACTTGTATGCCATATACTCGAGTATATGGCATACAAGTAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024260.4-3365s21c1
Sequence:CCGGGAGGATGAATGTACAGTATTTCTCGAGAAATACTGTACATTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024260
VALIDATED
CCDC132 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 132
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024260.2-278s1c1
Sequence:CCGGCGGATCCATTTGATATTGTTACTCGAGTAACAATATCAAATGGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024260.2-1569s1c1
Sequence:CCGGCCCATCAGTTTCACCTAGTAACTCGAGTTACTAGGTGAAACTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024260.4-2050s1c1
Sequence:CCGGCTATTACTTGTATGCCATATACTCGAGTATATGGCATACAAGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024260.4-3365s1c1
Sequence:CCGGGAGGATGAATGTACAGTATTTCTCGAGAAATACTGTACATTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024260.4-2591s1c1
Sequence:CCGGCAGTTTAACAAGCGGTTAAATCTCGAGATTTAACCGCTTGTTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024260.4-956s21c1
Sequence:CCGGGCCATTCACAACACCGTATTTCTCGAGAAATACGGTGTTGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024260.4-282s21c1
Sequence:CCGGATAGCATTGAACAAGTCTATTCTCGAGAATAGACTTGTTCAATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024260.4-1064s21c1
Sequence:CCGGGTGACACCAGACAGCTATATTCTCGAGAATATAGCTGTCTGGTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024260.4-2050s21c1
Sequence:CCGGCTATTACTTGTATGCCATATACTCGAGTATATGGCATACAAGTAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024260.4-3365s21c1
Sequence:CCGGGAGGATGAATGTACAGTATTTCTCGAGAAATACTGTACATTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks