EMAIL THIS PAGE TO A FRIEND

CCDC134

coiled-coil domain containing 134

66 Gene Product Result for
Synonyms: dJ821D11.3
UniProtKB ID: Q9H6E4
Gene ID:
Mouse(76457) coiled-coil domain containing 134
Rat(500909) coiled-coil domain containing 134
chicken(417984) coiled-coil domain containing 134
cow(516012) coiled-coil domain containing 134
domestic cat(101082250) coiled-coil domain containing 134
dog(100687689) coiled-coil domain containing 134
sheep(101112803) coiled-coil domain containing 134
domestic guinea pig(100713103) coiled-coil domain containing 134
naked mole-rat(101702166) coiled-coil domain containing 134
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024821 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024821 Rosetta Predictions human pricing
NM_001024355 Rosetta Predictions rat pricing
NM_172428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024899 predicted 485
2 SASI_Hs02_00357385 predicted 206
3 SASI_Hs01_00024900 predicted 476
4 SASI_Hs01_00024901 predicted 453
5 SASI_Hs01_00024903 predicted 439
6 SASI_Hs01_00024905 predicted 235
7 SASI_Hs01_00024906 predicted 484
8 SASI_Hs01_00024907 predicted 277
9 SASI_Hs01_00024908 predicted 237
10 SASI_Hs02_00357386 predicted 1028
11 SASI_Hs01_00024902 predicted 364
12 SASI_Hs01_00024904 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045601 predicted 761
2 SASI_Rn01_00045602 predicted 643
3 SASI_Rn01_00045604 predicted 573
4 SASI_Rn01_00045605 predicted 1208
5 SASI_Rn01_00045606 predicted 1182
6 SASI_Rn01_00045607 predicted 214
7 SASI_Rn01_00045609 predicted 875
8 SASI_Rn01_00045610 predicted 1240
9 SASI_Rn02_00202583 predicted 1071
10 SASI_Rn02_00202584 predicted 334
11 SASI_Rn01_00045603 predicted 1274
12 SASI_Rn01_00045608 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343904 predicted 881
2 SASI_Mm02_00343905 predicted 663
3 SASI_Mm02_00343906 predicted 873
4 SASI_Mm02_00343907 predicted 785
5 SASI_Mm02_00343908 predicted 670
6 SASI_Mm02_00343909 predicted 506
7 SASI_Mm02_00343910 predicted 870
8 SASI_Mm02_00343911 predicted 937
9 SASI_Mm02_00343912 predicted 447
10 SASI_Mm02_00343913 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024821
CCDC134 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 134
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024821.2-660s21c1
Sequence:CCGGTCGACCGCACAGAGTTCATTCCTCGAGGAATGAACTCTGTGCGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024821.2-777s21c1
Sequence:CCGGCCAGATCCCAGTCTGAGTTATCTCGAGATAACTCAGACTGGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024821.2-637s21c1
Sequence:CCGGCAACTTCCAGAACCCATTTAACTCGAGTTAAATGGGTTCTGGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024821.2-475s21c1
Sequence:CCGGCCCGAGGATTGTGCACTATTACTCGAGTAATAGTGCACAATCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024821.1-278s1c1
Sequence:CCGGCATCCACCAGCAGTACAAGATCTCGAGATCTTGTACTGCTGGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024821.1-711s1c1
Sequence:CCGGGAAGAGAAACGCCGAAAGAAACTCGAGTTTCTTTCGGCGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024821.1-293s1c1
Sequence:CCGGCAAGATCCTTGATGTCATGCTCTCGAGAGCATGACATCAAGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024821.1-201s1c1
Sequence:CCGGGAGATCTACAAGAAGATGTTTCTCGAGAAACATCTTCTTGTAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024821
CCDC134 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 134
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024821.2-660s21c1
Sequence:CCGGTCGACCGCACAGAGTTCATTCCTCGAGGAATGAACTCTGTGCGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024821.2-777s21c1
Sequence:CCGGCCAGATCCCAGTCTGAGTTATCTCGAGATAACTCAGACTGGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024821.2-637s21c1
Sequence:CCGGCAACTTCCAGAACCCATTTAACTCGAGTTAAATGGGTTCTGGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024821.2-475s21c1
Sequence:CCGGCCCGAGGATTGTGCACTATTACTCGAGTAATAGTGCACAATCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024821.1-278s1c1
Sequence:CCGGCATCCACCAGCAGTACAAGATCTCGAGATCTTGTACTGCTGGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024821.1-711s1c1
Sequence:CCGGGAAGAGAAACGCCGAAAGAAACTCGAGTTTCTTTCGGCGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024821.1-293s1c1
Sequence:CCGGCAAGATCCTTGATGTCATGCTCTCGAGAGCATGACATCAAGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024821.1-201s1c1
Sequence:CCGGGAGATCTACAAGAAGATGTTTCTCGAGAAACATCTTCTTGTAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024821
CCDC134 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 134
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024821.2-660s21c1
Sequence:CCGGTCGACCGCACAGAGTTCATTCCTCGAGGAATGAACTCTGTGCGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024821.2-777s21c1
Sequence:CCGGCCAGATCCCAGTCTGAGTTATCTCGAGATAACTCAGACTGGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024821.2-637s21c1
Sequence:CCGGCAACTTCCAGAACCCATTTAACTCGAGTTAAATGGGTTCTGGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024821.2-475s21c1
Sequence:CCGGCCCGAGGATTGTGCACTATTACTCGAGTAATAGTGCACAATCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024821.1-278s1c1
Sequence:CCGGCATCCACCAGCAGTACAAGATCTCGAGATCTTGTACTGCTGGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024821.1-711s1c1
Sequence:CCGGGAAGAGAAACGCCGAAAGAAACTCGAGTTTCTTTCGGCGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024821.1-293s1c1
Sequence:CCGGCAAGATCCTTGATGTCATGCTCTCGAGAGCATGACATCAAGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024821.1-201s1c1
Sequence:CCGGGAGATCTACAAGAAGATGTTTCTCGAGAAACATCTTCTTGTAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172428
VALIDATED
CCDC134 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 134
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172428.2-525s1c1
Sequence:CCGGCCACTACTTTGACCATAATTCCTCGAGGAATTATGGTCAAAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172428.1-239s1c1
Sequence:CCGGGAATGACATCCACCAGCAGTACTCGAGTACTGCTGGTGGATGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172428.1-288s1c1
Sequence:CCGGCTCTTCAAGGTGTGTCAGGAACTCGAGTTCCTGACACACCTTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172428.1-4687s1c1
Sequence:CCGGGCCTTGGTTCTATTGAAATTACTCGAGTAATTTCAATAGAACCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172428.1-257s1c1
Sequence:CCGGGTACAAGATCCTGGATGTCATCTCGAGATGACATCCAGGATCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172428.1-158s1c1
Sequence:CCGGCCCGAGCCTCAAGATTTACAACTCGAGTTGTAAATCTTGAGGCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172428.1-252s1c1
Sequence:CCGGCAGCAGTACAAGATCCTGGATCTCGAGATCCAGGATCTTGTACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172428
VALIDATED
CCDC134 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 134
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172428.2-525s1c1
Sequence:CCGGCCACTACTTTGACCATAATTCCTCGAGGAATTATGGTCAAAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172428.1-239s1c1
Sequence:CCGGGAATGACATCCACCAGCAGTACTCGAGTACTGCTGGTGGATGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172428.1-288s1c1
Sequence:CCGGCTCTTCAAGGTGTGTCAGGAACTCGAGTTCCTGACACACCTTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172428.1-4687s1c1
Sequence:CCGGGCCTTGGTTCTATTGAAATTACTCGAGTAATTTCAATAGAACCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172428.1-257s1c1
Sequence:CCGGGTACAAGATCCTGGATGTCATCTCGAGATGACATCCAGGATCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172428.1-158s1c1
Sequence:CCGGCCCGAGCCTCAAGATTTACAACTCGAGTTGTAAATCTTGAGGCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172428.1-252s1c1
Sequence:CCGGCAGCAGTACAAGATCCTGGATCTCGAGATCCAGGATCTTGTACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172428
VALIDATED
CCDC134 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 134
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172428.2-525s1c1
Sequence:CCGGCCACTACTTTGACCATAATTCCTCGAGGAATTATGGTCAAAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172428.1-239s1c1
Sequence:CCGGGAATGACATCCACCAGCAGTACTCGAGTACTGCTGGTGGATGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172428.1-288s1c1
Sequence:CCGGCTCTTCAAGGTGTGTCAGGAACTCGAGTTCCTGACACACCTTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172428.1-4687s1c1
Sequence:CCGGGCCTTGGTTCTATTGAAATTACTCGAGTAATTTCAATAGAACCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172428.1-257s1c1
Sequence:CCGGGTACAAGATCCTGGATGTCATCTCGAGATGACATCCAGGATCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172428.1-158s1c1
Sequence:CCGGCCCGAGCCTCAAGATTTACAACTCGAGTTGTAAATCTTGAGGCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172428.1-252s1c1
Sequence:CCGGCAGCAGTACAAGATCCTGGATCTCGAGATCCAGGATCTTGTACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks