EMAIL THIS PAGE TO A FRIEND

CCDC135

coiled-coil domain containing 135

Synonyms: C16orf50 FAP50
UniProtKB ID: Q8IY82, A8K943, Q8NAA0, Q9H080
Gene ID:
Mouse(330830) coiled-coil domain containing 135
Rat(291853) coiled-coil domain containing 135
naked mole-rat(101722741) coiled-coil domain containing 135
domestic guinea pig(100714492) coiled-coil domain containing 135
sheep(101102834) coiled-coil domain containing 135
Domestic Rabbit(100358603) coiled-coil domain containing 135
chicken(427527) coiled-coil domain containing 135
domestic cat(101086272) coiled-coil domain containing 135
cow(504736) coiled-coil domain containing 135
dog(487260) coiled-coil domain containing 135
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032269 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001042715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001042715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001042715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151661 MISSION® esiRNA esiRNA human C16orf50 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032269 Rosetta Predictions human pricing
NM_001106169 Rosetta Predictions rat pricing
NM_001042715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029058 predicted 1706
2 SASI_Hs01_00029059 predicted 493
3 SASI_Hs01_00029060 predicted 1014
4 SASI_Hs01_00029061 predicted 1618
5 SASI_Hs01_00029062 predicted 659
6 SASI_Hs01_00029063 predicted 1773
7 SASI_Hs01_00029064 predicted 1290
8 SASI_Hs01_00029065 predicted 798
9 SASI_Hs01_00029066 predicted 1035
10 SASI_Hs01_00029067 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216308 predicted 882
2 SASI_Rn02_00216309 predicted 1061
3 SASI_Rn02_00216310 predicted 460
4 SASI_Rn02_00216311 predicted 1707
5 SASI_Rn02_00216312 predicted 2125
6 SASI_Rn02_00216313 predicted 1963
7 SASI_Rn02_00216314 predicted 851
8 SASI_Rn02_00216315 predicted 1104
9 SASI_Rn02_00216316 predicted 403
10 SASI_Rn02_00216317 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291035 predicted 758
2 SASI_Mm02_00291036 predicted 1588
3 SASI_Mm02_00291037 predicted 340
4 SASI_Mm02_00291038 predicted 860
5 SASI_Mm02_00291039 predicted 296
6 SASI_Mm02_00291040 predicted 1941
7 SASI_Mm02_00291041 predicted 1759
8 SASI_Mm02_00291042 predicted 474
9 SASI_Mm02_00291043 predicted 413
10 SASI_Mm02_00291044 predicted 776
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032269
CCDC135 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 135
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032269.3-1238s1c1
Sequence:CCGGGAAGAAGACGACAGTGGGATACTCGAGTATCCCACTGTCGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032269.3-2224s1c1
Sequence:CCGGCATCTATGACACCAAGCGGAACTCGAGTTCCGCTTGGTGTCATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137798    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032269.3-2733s1c1
Sequence:CCGGGCCAGAGAAAGGAAACCTCTTCTCGAGAAGAGGTTTCCTTTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032269.3-2242s1c1
Sequence:CCGGGAATGAGAAGAGCAAGGAATACTCGAGTATTCCTTGCTCTTCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-193s1c1
Sequence:CCGGGAAGGAGGAAATCACCTTAAACTCGAGTTTAAGGTGATTTCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-2005s1c1
Sequence:CCGGCAAAGGCAACAAGATCATCATCTCGAGATGATGATCTTGTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032269.3-1537s1c1
Sequence:CCGGGCTGGAGCTGAAACACATAAACTCGAGTTTATGTGTTTCAGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-1027s1c1
Sequence:CCGGGAACTTCTTCATCGACCCATTCTCGAGAATGGGTCGATGAAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-607s1c1
Sequence:CCGGCACTGTGCTCAAGTACCAGAACTCGAGTTCTGGTACTTGAGCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-1619s1c1
Sequence:CCGGCACTCGTACAAGTCCATGCAACTCGAGTTGCATGGACTTGTACGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032269
CCDC135 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 135
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032269.3-1238s1c1
Sequence:CCGGGAAGAAGACGACAGTGGGATACTCGAGTATCCCACTGTCGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032269.3-2224s1c1
Sequence:CCGGCATCTATGACACCAAGCGGAACTCGAGTTCCGCTTGGTGTCATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137798    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032269.3-2733s1c1
Sequence:CCGGGCCAGAGAAAGGAAACCTCTTCTCGAGAAGAGGTTTCCTTTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032269.3-2242s1c1
Sequence:CCGGGAATGAGAAGAGCAAGGAATACTCGAGTATTCCTTGCTCTTCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-193s1c1
Sequence:CCGGGAAGGAGGAAATCACCTTAAACTCGAGTTTAAGGTGATTTCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-2005s1c1
Sequence:CCGGCAAAGGCAACAAGATCATCATCTCGAGATGATGATCTTGTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032269.3-1537s1c1
Sequence:CCGGGCTGGAGCTGAAACACATAAACTCGAGTTTATGTGTTTCAGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-1027s1c1
Sequence:CCGGGAACTTCTTCATCGACCCATTCTCGAGAATGGGTCGATGAAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-607s1c1
Sequence:CCGGCACTGTGCTCAAGTACCAGAACTCGAGTTCTGGTACTTGAGCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-1619s1c1
Sequence:CCGGCACTCGTACAAGTCCATGCAACTCGAGTTGCATGGACTTGTACGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032269
CCDC135 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 135
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032269.3-1238s1c1
Sequence:CCGGGAAGAAGACGACAGTGGGATACTCGAGTATCCCACTGTCGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032269.3-2224s1c1
Sequence:CCGGCATCTATGACACCAAGCGGAACTCGAGTTCCGCTTGGTGTCATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137798    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032269.3-2733s1c1
Sequence:CCGGGCCAGAGAAAGGAAACCTCTTCTCGAGAAGAGGTTTCCTTTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032269.3-2242s1c1
Sequence:CCGGGAATGAGAAGAGCAAGGAATACTCGAGTATTCCTTGCTCTTCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-193s1c1
Sequence:CCGGGAAGGAGGAAATCACCTTAAACTCGAGTTTAAGGTGATTTCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-2005s1c1
Sequence:CCGGCAAAGGCAACAAGATCATCATCTCGAGATGATGATCTTGTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032269.3-1537s1c1
Sequence:CCGGGCTGGAGCTGAAACACATAAACTCGAGTTTATGTGTTTCAGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-1027s1c1
Sequence:CCGGGAACTTCTTCATCGACCCATTCTCGAGAATGGGTCGATGAAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-607s1c1
Sequence:CCGGCACTGTGCTCAAGTACCAGAACTCGAGTTCTGGTACTTGAGCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032269.3-1619s1c1
Sequence:CCGGCACTCGTACAAGTCCATGCAACTCGAGTTGCATGGACTTGTACGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042715
CCDC135 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 135
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000252539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042715.3-2647s21c1
Sequence:CCGGACGCTTAATAGACTTCGTAAACTCGAGTTTACGAAGTCTATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042715.3-395s21c1
Sequence:CCGGCTCTTCTTGCACCCGTTAAATCTCGAGATTTAACGGGTGCAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042715.3-868s21c1
Sequence:CCGGTCTAGAACAAAGGCGACTTAACTCGAGTTAAGTCGCCTTTGTTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042715.3-1628s21c1
Sequence:CCGGCGCGTCATGGAGTTCTATAAACTCGAGTTTATAGAACTCCATGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042715
CCDC135 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 135
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000252539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042715.3-2647s21c1
Sequence:CCGGACGCTTAATAGACTTCGTAAACTCGAGTTTACGAAGTCTATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042715.3-395s21c1
Sequence:CCGGCTCTTCTTGCACCCGTTAAATCTCGAGATTTAACGGGTGCAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042715.3-868s21c1
Sequence:CCGGTCTAGAACAAAGGCGACTTAACTCGAGTTAAGTCGCCTTTGTTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042715.3-1628s21c1
Sequence:CCGGCGCGTCATGGAGTTCTATAAACTCGAGTTTATAGAACTCCATGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042715
CCDC135 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 135
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000252539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042715.3-2647s21c1
Sequence:CCGGACGCTTAATAGACTTCGTAAACTCGAGTTTACGAAGTCTATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042715.3-395s21c1
Sequence:CCGGCTCTTCTTGCACCCGTTAAATCTCGAGATTTAACGGGTGCAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042715.3-868s21c1
Sequence:CCGGTCTAGAACAAAGGCGACTTAACTCGAGTTAAGTCGCCTTTGTTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042715.3-1628s21c1
Sequence:CCGGCGCGTCATGGAGTTCTATAAACTCGAGTTTATAGAACTCCATGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks