EMAIL THIS PAGE TO A FRIEND

CCDC136

coiled-coil domain containing 136

65 Gene Product Result for
Gene ID:
Mouse(232664) coiled-coil domain containing 136
Rat(362331) coiled-coil domain containing 136
cow(615922) coiled-coil domain containing 136
Horse(100056893) coiled-coil domain containing 136
domestic cat(101080958) coiled-coil domain containing 136
dog(100686370) coiled-coil domain containing 136
sheep(101112476) coiled-coil domain containing 136
domestic guinea pig(100729744) coiled-coil domain containing 136
naked mole-rat(101716309) coiled-coil domain containing 136
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022742 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_485735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_485735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_485735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083981 MISSION® esiRNA esiRNA human CCDC136 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022742 Rosetta Predictions human pricing
XM_001064000 Rosetta Predictions rat pricing
XM_342652 Rosetta Predictions rat pricing
XM_485735 Rosetta Predictions mouse pricing
XM_908853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233846 predicted 2364
2 SASI_Hs01_00233848 predicted 1013
3 SASI_Hs01_00233849 predicted 2140
4 SASI_Hs01_00233850 predicted 2959
5 SASI_Hs01_00233851 predicted 981
6 SASI_Hs01_00233852 predicted 3862
7 SASI_Hs01_00233853 predicted 2242
8 SASI_Hs01_00233854 predicted 1952
9 SASI_Hs01_00233855 predicted 2641
10 SASI_Hs02_00355987 predicted 998
11 SASI_Hs01_00233847 predicted 2307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308993 predicted 2273
2 SASI_Rn02_00308994 predicted 2605
3 SASI_Rn02_00308995 predicted 3107
4 SASI_Rn02_00308996 predicted 2243
5 SASI_Rn02_00308997 predicted 2746
6 SASI_Rn02_00308998 predicted 1477
7 SASI_Rn02_00308999 predicted 2213
8 SASI_Rn02_00309000 predicted 2538
9 SASI_Rn02_00309001 predicted 2906
10 SASI_Rn02_00309002 predicted 2148
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394600 predicted 2265
2 SASI_Rn02_00394601 predicted 2603
3 SASI_Rn02_00394602 predicted 3108
4 SASI_Rn02_00394603 predicted 2241
5 SASI_Rn02_00394604 predicted 2752
6 SASI_Rn02_00394605 predicted 1475
7 SASI_Rn02_00394606 predicted 2212
8 SASI_Rn02_00394607 predicted 2539
9 SASI_Rn02_00394608 predicted 2902
10 SASI_Rn02_00394609 predicted 2149
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273925 predicted 2047
2 SASI_Mm01_00273926 predicted 2331
3 SASI_Mm01_00273927 predicted 2281
4 SASI_Mm01_00273928 predicted 2269
5 SASI_Mm01_00273929 predicted 1862
6 SASI_Mm02_00426699 predicted 2039
7 SASI_Mm01_00273930 predicted 2139
8 SASI_Mm01_00273931 predicted 2390
9 SASI_Mm01_00273932 predicted 2222
10 SASI_Mm01_00273933 predicted 1256
11 SASI_Mm01_00273934 predicted 1731
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434434 predicted 1957
2 SASI_Mm02_00434435 predicted 2704
3 SASI_Mm02_00434436 predicted 1943
4 SASI_Mm02_00434437 predicted 1037
5 SASI_Mm02_00434438 predicted 877
6 SASI_Mm02_00434439 predicted 2142
7 SASI_Mm02_00434440 predicted 1499
8 SASI_Mm02_00434441 predicted 2490
9 SASI_Mm02_00434442 predicted 886
10 SASI_Mm02_00434443 predicted 2350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022742
VALIDATED
CCDC136 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 136
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022742.3-3117s21c2
Sequence:CCGGACGACAAGAATGAGATCAAAGCTCGAGCTTTGATCTCATTCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022742.3-989s21c2
Sequence:CCGGTCTGAACCATCCGGTAGTTTACTCGAGTAAACTACCGGATGGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022742.3-757s21c2
Sequence:CCGGTGAGAAAGAAAGCGAACTTAACTCGAGTTAAGTTCGCTTTCTTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022742.3-2665s21c2
Sequence:GTACCGGGGATGACAATGAGAGCTATTACTCGAGTAATAGCTCTCATTGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022742.3-3849s21c2
Sequence:CCGGGTTGTGGAAGCCTATGGTATTCTCGAGAATACCATAGGCTTCCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022742.2-3883s1c1
Sequence:CCGGGCTGTGGCTCTGTATGTGTTACTCGAGTAACACATACAGAGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_022742.2-2305s1c1
Sequence:CCGGGCGACGTTTCAAAGAGTCTCACTCGAGTGAGACTCTTTGAAACGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_022742.2-1205s1c1
Sequence:CCGGGCAGAGTCTCAGACTTCAGAACTCGAGTTCTGAAGTCTGAGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022742.2-3849s1c1
Sequence:CCGGGTTGTGGAAGCCTATGGTATTCTCGAGAATACCATAGGCTTCCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022742.2-2306s1c1
Sequence:CCGGCGACGTTTCAAAGAGTCTCATCTCGAGATGAGACTCTTTGAAACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022742
VALIDATED
CCDC136 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 136
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022742.3-3117s21c2
Sequence:CCGGACGACAAGAATGAGATCAAAGCTCGAGCTTTGATCTCATTCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022742.3-989s21c2
Sequence:CCGGTCTGAACCATCCGGTAGTTTACTCGAGTAAACTACCGGATGGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022742.3-757s21c2
Sequence:CCGGTGAGAAAGAAAGCGAACTTAACTCGAGTTAAGTTCGCTTTCTTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022742.3-2665s21c2
Sequence:GTACCGGGGATGACAATGAGAGCTATTACTCGAGTAATAGCTCTCATTGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022742.3-3849s21c2
Sequence:CCGGGTTGTGGAAGCCTATGGTATTCTCGAGAATACCATAGGCTTCCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022742.2-3883s1c1
Sequence:CCGGGCTGTGGCTCTGTATGTGTTACTCGAGTAACACATACAGAGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_022742.2-2305s1c1
Sequence:CCGGGCGACGTTTCAAAGAGTCTCACTCGAGTGAGACTCTTTGAAACGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_022742.2-1205s1c1
Sequence:CCGGGCAGAGTCTCAGACTTCAGAACTCGAGTTCTGAAGTCTGAGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022742.2-3849s1c1
Sequence:CCGGGTTGTGGAAGCCTATGGTATTCTCGAGAATACCATAGGCTTCCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022742.2-2306s1c1
Sequence:CCGGCGACGTTTCAAAGAGTCTCATCTCGAGATGAGACTCTTTGAAACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022742
VALIDATED
CCDC136 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 136
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022742.3-3117s21c2
Sequence:CCGGACGACAAGAATGAGATCAAAGCTCGAGCTTTGATCTCATTCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022742.3-989s21c2
Sequence:CCGGTCTGAACCATCCGGTAGTTTACTCGAGTAAACTACCGGATGGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022742.3-757s21c2
Sequence:CCGGTGAGAAAGAAAGCGAACTTAACTCGAGTTAAGTTCGCTTTCTTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022742.3-2665s21c2
Sequence:GTACCGGGGATGACAATGAGAGCTATTACTCGAGTAATAGCTCTCATTGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022742.3-3849s21c2
Sequence:CCGGGTTGTGGAAGCCTATGGTATTCTCGAGAATACCATAGGCTTCCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022742.2-3883s1c1
Sequence:CCGGGCTGTGGCTCTGTATGTGTTACTCGAGTAACACATACAGAGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_022742.2-2305s1c1
Sequence:CCGGGCGACGTTTCAAAGAGTCTCACTCGAGTGAGACTCTTTGAAACGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_022742.2-1205s1c1
Sequence:CCGGGCAGAGTCTCAGACTTCAGAACTCGAGTTCTGAAGTCTGAGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022742.2-3849s1c1
Sequence:CCGGGTTGTGGAAGCCTATGGTATTCTCGAGAATACCATAGGCTTCCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022742.2-2306s1c1
Sequence:CCGGCGACGTTTCAAAGAGTCTCATCTCGAGATGAGACTCTTTGAAACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_485735
VALIDATED
CCDC136 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 136
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_485735.1-2915s1c1
Sequence:CCGGGCAGCACAAGTGTGAGCTATACTCGAGTATAGCTCACACTTGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_485735.5-670s1c1
Sequence:CCGGGAGAAGGAAAGCGAACTTAAACTCGAGTTTAAGTTCGCTTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_485735.1-1038s1c1
Sequence:CCGGGCAGAATGATCTCGATGACATCTCGAGATGTCATCGAGATCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485735.1-41s1c1
Sequence:CCGGGCCATTTAAGTCTGGCACTAACTCGAGTTAGTGCCAGACTTAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_485735.1-427s1c1
Sequence:CCGGGTAACCACTTTAGGCTCCTATCTCGAGATAGGAGCCTAAAGTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_485735.1-2565s1c1
Sequence:CCGGGCTATATGACACCAGTCAGAACTCGAGTTCTGACTGGTGTCATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_485735.1-2440s1c1
Sequence:CCGGCGAGGTTTCAAAGAGTCTCATCTCGAGATGAGACTCTTTGAAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_485735
VALIDATED
CCDC136 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 136
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_485735.1-2915s1c1
Sequence:CCGGGCAGCACAAGTGTGAGCTATACTCGAGTATAGCTCACACTTGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_485735.5-670s1c1
Sequence:CCGGGAGAAGGAAAGCGAACTTAAACTCGAGTTTAAGTTCGCTTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_485735.1-1038s1c1
Sequence:CCGGGCAGAATGATCTCGATGACATCTCGAGATGTCATCGAGATCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485735.1-41s1c1
Sequence:CCGGGCCATTTAAGTCTGGCACTAACTCGAGTTAGTGCCAGACTTAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_485735.1-427s1c1
Sequence:CCGGGTAACCACTTTAGGCTCCTATCTCGAGATAGGAGCCTAAAGTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_485735.1-2565s1c1
Sequence:CCGGGCTATATGACACCAGTCAGAACTCGAGTTCTGACTGGTGTCATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_485735.1-2440s1c1
Sequence:CCGGCGAGGTTTCAAAGAGTCTCATCTCGAGATGAGACTCTTTGAAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_485735
VALIDATED
CCDC136 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 136
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_485735.1-2915s1c1
Sequence:CCGGGCAGCACAAGTGTGAGCTATACTCGAGTATAGCTCACACTTGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_485735.5-670s1c1
Sequence:CCGGGAGAAGGAAAGCGAACTTAAACTCGAGTTTAAGTTCGCTTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_485735.1-1038s1c1
Sequence:CCGGGCAGAATGATCTCGATGACATCTCGAGATGTCATCGAGATCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485735.1-41s1c1
Sequence:CCGGGCCATTTAAGTCTGGCACTAACTCGAGTTAGTGCCAGACTTAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_485735.1-427s1c1
Sequence:CCGGGTAACCACTTTAGGCTCCTATCTCGAGATAGGAGCCTAAAGTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_485735.1-2565s1c1
Sequence:CCGGGCTATATGACACCAGTCAGAACTCGAGTTCTGACTGGTGTCATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_485735.1-2440s1c1
Sequence:CCGGCGAGGTTTCAAAGAGTCTCATCTCGAGATGAGACTCTTTGAAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks