EMAIL THIS PAGE TO A FRIEND

CCDC137

coiled-coil domain containing 137

63 Gene Product Result for
UniProtKB ID: Q6PK04
Gene ID:
Mouse(67291) coiled-coil domain containing 137
Rat(688298) coiled-coil domain containing 137
chicken(417454) coiled-coil domain containing 137
domestic cat(101098671) coiled-coil domain containing 137
cow(511225) coiled-coil domain containing 137
dog(608071) coiled-coil domain containing 137
naked mole-rat(101726587) coiled-coil domain containing 137
domestic guinea pig(100712718) coiled-coil domain containing 137
sheep(101117002) coiled-coil domain containing 137
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199287 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199287 Rosetta Predictions human pricing
XM_375500 Rosetta Predictions human pricing
XM_934659 Rosetta Predictions human pricing
XM_001081807 Rosetta Predictions rat pricing
NM_152807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372708 predicted 1062
2 SASI_Hs02_00372709 predicted 1032
3 SASI_Hs02_00372710 predicted 1028
4 SASI_Hs02_00372711 predicted 1117
5 SASI_Hs02_00372712 predicted 205
6 SASI_Hs02_00372713 predicted 950
7 SASI_Hs02_00372714 predicted 218
8 SASI_Hs02_00372715 predicted 218
9 SASI_Hs02_00372716 predicted 1211
10 SASI_Hs02_00372717 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_375500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264247 predicted 2582
2 SASI_Hs01_00264248 predicted 2495
3 SASI_Hs01_00264249 predicted 2585
4 SASI_Hs01_00264250 predicted 2452
5 SASI_Hs01_00264251 predicted 2651
6 SASI_Hs01_00264252 predicted 2669
7 SASI_Hs01_00264253 predicted 2635
8 SASI_Hs01_00264254 predicted 2464
9 SASI_Hs01_00264255 predicted 2642
10 SASI_Hs01_00264256 predicted 2501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271892 predicted 1945
2 SASI_Hs01_00271893 predicted 1844
3 SASI_Hs01_00271894 predicted 1843
4 SASI_Hs01_00271895 predicted 1845
5 SASI_Hs01_00271896 predicted 1683
6 SASI_Hs01_00271897 predicted 1894
7 SASI_Hs01_00271898 predicted 1888
8 SASI_Hs01_00271899 predicted 1884
9 SASI_Hs01_00271900 predicted 1685
10 SASI_Hs01_00271901 predicted 1911
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373592 predicted 985
2 SASI_Rn02_00373593 predicted 769
3 SASI_Rn02_00373594 predicted 661
4 SASI_Rn02_00373595 predicted 881
5 SASI_Rn02_00373596 predicted 770
6 SASI_Rn02_00373597 predicted 589
7 SASI_Rn02_00373598 predicted 804
8 SASI_Rn02_00373599 predicted 983
9 SASI_Rn02_00373600 predicted 870
10 SASI_Rn02_00373601 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036075 predicted 1136
2 SASI_Mm01_00036076 predicted 1115
3 SASI_Mm02_00342808 predicted 655
4 SASI_Mm01_00036077 predicted 986
5 SASI_Mm01_00036078 predicted 291
6 SASI_Mm01_00036079 predicted 489
7 SASI_Mm01_00036080 predicted 557
8 SASI_Mm01_00036081 predicted 872
9 SASI_Mm01_00036082 predicted 547
10 SASI_Mm01_00036083 predicted 968
11 SASI_Mm01_00036084 predicted 1089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152807
VALIDATED
CCDC137 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 137
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152807.3-486s21c1
Sequence:CCGGAGAAGTCTGAGCGCAAGAAAGCTCGAGCTTTCTTGCGCTCAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152807.3-2419s21c1
Sequence:CCGGGGAGCCTGTCCACCATTATATCTCGAGATATAATGGTGGACAGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152807.3-209s21c1
Sequence:CCGGTTTCGGCTCCGAGAAATTATGCTCGAGCATAATTTCTCGGAGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152807.3-663s21c1
Sequence:CCGGGAGATGCTCCTGGCAAGAAATCTCGAGATTTCTTGCCAGGAGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152807.3-184s21c1
Sequence:CCGGGAACCAGGATGAGCAAGAAATCTCGAGATTTCTTGCTCATCCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152807
VALIDATED
CCDC137 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 137
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152807.3-486s21c1
Sequence:CCGGAGAAGTCTGAGCGCAAGAAAGCTCGAGCTTTCTTGCGCTCAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152807.3-2419s21c1
Sequence:CCGGGGAGCCTGTCCACCATTATATCTCGAGATATAATGGTGGACAGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152807.3-209s21c1
Sequence:CCGGTTTCGGCTCCGAGAAATTATGCTCGAGCATAATTTCTCGGAGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152807.3-663s21c1
Sequence:CCGGGAGATGCTCCTGGCAAGAAATCTCGAGATTTCTTGCCAGGAGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152807.3-184s21c1
Sequence:CCGGGAACCAGGATGAGCAAGAAATCTCGAGATTTCTTGCTCATCCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152807
VALIDATED
CCDC137 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 137
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152807.3-486s21c1
Sequence:CCGGAGAAGTCTGAGCGCAAGAAAGCTCGAGCTTTCTTGCGCTCAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152807.3-2419s21c1
Sequence:CCGGGGAGCCTGTCCACCATTATATCTCGAGATATAATGGTGGACAGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152807.3-209s21c1
Sequence:CCGGTTTCGGCTCCGAGAAATTATGCTCGAGCATAATTTCTCGGAGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152807.3-663s21c1
Sequence:CCGGGAGATGCTCCTGGCAAGAAATCTCGAGATTTCTTGCCAGGAGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152807.3-184s21c1
Sequence:CCGGGAACCAGGATGAGCAAGAAATCTCGAGATTTCTTGCTCATCCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199287
VALIDATED
CCDC137 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 137
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199287.2-611s21c1
Sequence:CCGGTCCGAGACACGGTGAAGTTTGCTCGAGCAAACTTCACCGTGTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_199287.2-206s21c1
Sequence:CCGGACCAGGACGAACAGGAGATTCCTCGAGGAATCTCCTGTTCGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_199287.2-228s21c1
Sequence:CCGGTTTCCGGCTCCGGGAGATTATCTCGAGATAATCTCCCGGAGCCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_199287.2-1431s21c1
Sequence:CCGGGATGACAACACATACACTTAACTCGAGTTAAGTGTATGTGTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_199287.2-550s21c1
Sequence:CCGGCTAGATAAAGTCCGACGGAAACTCGAGTTTCCGTCGGACTTTATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199287
VALIDATED
CCDC137 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 137
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199287.2-611s21c1
Sequence:CCGGTCCGAGACACGGTGAAGTTTGCTCGAGCAAACTTCACCGTGTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_199287.2-206s21c1
Sequence:CCGGACCAGGACGAACAGGAGATTCCTCGAGGAATCTCCTGTTCGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_199287.2-228s21c1
Sequence:CCGGTTTCCGGCTCCGGGAGATTATCTCGAGATAATCTCCCGGAGCCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_199287.2-1431s21c1
Sequence:CCGGGATGACAACACATACACTTAACTCGAGTTAAGTGTATGTGTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_199287.2-550s21c1
Sequence:CCGGCTAGATAAAGTCCGACGGAAACTCGAGTTTCCGTCGGACTTTATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199287
VALIDATED
CCDC137 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 137
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199287.2-611s21c1
Sequence:CCGGTCCGAGACACGGTGAAGTTTGCTCGAGCAAACTTCACCGTGTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_199287.2-206s21c1
Sequence:CCGGACCAGGACGAACAGGAGATTCCTCGAGGAATCTCCTGTTCGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_199287.2-228s21c1
Sequence:CCGGTTTCCGGCTCCGGGAGATTATCTCGAGATAATCTCCCGGAGCCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_199287.2-1431s21c1
Sequence:CCGGGATGACAACACATACACTTAACTCGAGTTAAGTGTATGTGTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_199287.2-550s21c1
Sequence:CCGGCTAGATAAAGTCCGACGGAAACTCGAGTTTCCGTCGGACTTTATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks