EMAIL THIS PAGE TO A FRIEND

CCDC13

coiled-coil domain containing 13

35 Gene Product Result for
UniProtKB ID: Q8IYE1
Gene ID:
Mouse(100502861) coiled-coil domain containing 13
Rat(686091) coiled-coil domain containing 13
naked mole-rat(101713723) coiled-coil domain containing 13
domestic guinea pig(100713042) coiled-coil domain containing 13
sheep(101117705) coiled-coil domain containing 13
Domestic Rabbit(100350909) coiled-coil domain containing 13
chicken(420392) coiled-coil domain containing 13
domestic cat(101094874) coiled-coil domain containing 13
cow(538960) coiled-coil domain containing 13
Horse(100067284) coiled-coil domain containing 13
dog(609625) coiled-coil domain containing 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144719 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144719 Rosetta Predictions human pricing
XM_001066510 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081017 predicted 965
2 SASI_Hs01_00081018 predicted 1453
3 SASI_Hs01_00081019 predicted 305
4 SASI_Hs02_00364660 predicted 1872
5 SASI_Hs01_00081020 predicted 2220
6 SASI_Hs01_00081021 predicted 1504
7 SASI_Hs01_00081022 predicted 520
8 SASI_Hs01_00081023 predicted 728
9 SASI_Hs01_00081024 predicted 2210
10 SASI_Hs01_00081025 predicted 1164
11 SASI_Hs01_00081026 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317727 predicted 3029
2 SASI_Rn02_00317728 predicted 2403
3 SASI_Rn02_00317729 predicted 2138
4 SASI_Rn02_00317730 predicted 2874
5 SASI_Rn02_00317731 predicted 3153
6 SASI_Rn02_00317732 predicted 3093
7 SASI_Rn02_00317733 predicted 2913
8 SASI_Rn02_00317734 predicted 2905
9 SASI_Rn02_00317735 predicted 2593
10 SASI_Rn02_00317736 predicted 2862
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144719
CCDC13 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144719.2-912s1c1
Sequence:CCGGGTTCAAGAGCTTGAGAAGCAACTCGAGTTGCTTCTCAAGCTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144719.2-149s1c1
Sequence:CCGGGCAGCACAAACGGTTACAGAACTCGAGTTCTGTAACCGTTTGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144719.2-435s1c1
Sequence:CCGGGAGGACAGATTTGCCTTCACACTCGAGTGTGAAGGCAAATCTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144719.3-2034s21c1
Sequence:CCGGTGTGCCCGTGGAATCCCAAATCTCGAGATTTGGGATTCCACGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144719.3-359s21c1
Sequence:CCGGACGAGAACGGGCGATTGTATACTCGAGTATACAATCGCCCGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144719.3-1450s21c1
Sequence:CCGGGTGCACTATCTTCGGAATAAACTCGAGTTTATTCCGAAGATAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144719.3-320s21c1
Sequence:CCGGAGATTGAACACCTTCGAAATGCTCGAGCATTTCGAAGGTGTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144719.3-2353s21c1
Sequence:CCGGCTACCAGAAGAGGCTCCTTAACTCGAGTTAAGGAGCCTCTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144719
CCDC13 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144719.2-912s1c1
Sequence:CCGGGTTCAAGAGCTTGAGAAGCAACTCGAGTTGCTTCTCAAGCTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144719.2-149s1c1
Sequence:CCGGGCAGCACAAACGGTTACAGAACTCGAGTTCTGTAACCGTTTGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144719.2-435s1c1
Sequence:CCGGGAGGACAGATTTGCCTTCACACTCGAGTGTGAAGGCAAATCTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144719.3-2034s21c1
Sequence:CCGGTGTGCCCGTGGAATCCCAAATCTCGAGATTTGGGATTCCACGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144719.3-359s21c1
Sequence:CCGGACGAGAACGGGCGATTGTATACTCGAGTATACAATCGCCCGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144719.3-1450s21c1
Sequence:CCGGGTGCACTATCTTCGGAATAAACTCGAGTTTATTCCGAAGATAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144719.3-320s21c1
Sequence:CCGGAGATTGAACACCTTCGAAATGCTCGAGCATTTCGAAGGTGTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144719.3-2353s21c1
Sequence:CCGGCTACCAGAAGAGGCTCCTTAACTCGAGTTAAGGAGCCTCTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144719
CCDC13 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144719.2-912s1c1
Sequence:CCGGGTTCAAGAGCTTGAGAAGCAACTCGAGTTGCTTCTCAAGCTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144719.2-149s1c1
Sequence:CCGGGCAGCACAAACGGTTACAGAACTCGAGTTCTGTAACCGTTTGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144719.2-435s1c1
Sequence:CCGGGAGGACAGATTTGCCTTCACACTCGAGTGTGAAGGCAAATCTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144719.3-2034s21c1
Sequence:CCGGTGTGCCCGTGGAATCCCAAATCTCGAGATTTGGGATTCCACGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144719.3-359s21c1
Sequence:CCGGACGAGAACGGGCGATTGTATACTCGAGTATACAATCGCCCGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144719.3-1450s21c1
Sequence:CCGGGTGCACTATCTTCGGAATAAACTCGAGTTTATTCCGAAGATAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144719.3-320s21c1
Sequence:CCGGAGATTGAACACCTTCGAAATGCTCGAGCATTTCGAAGGTGTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144719.3-2353s21c1
Sequence:CCGGCTACCAGAAGAGGCTCCTTAACTCGAGTTAAGGAGCCTCTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks