EMAIL THIS PAGE TO A FRIEND

CCDC140

coiled-coil domain containing 140

30 Gene Product Result for
Species: Human CCDC140(151278)
UniProtKB ID: Q96MF4
Gene ID:
Human(151278) Summary: This gene encodes a protein that appears to be restricted to select higher primate species. This protein contains a C-terminal coiled-coil domain, which is a versatile structural motif consisting of multiple amphipathic alpha-helices that twist around each other to form a supercoil. [provided by RefSeq, Aug 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153038 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153038 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234398 predicted 1191
2 SASI_Hs01_00234400 predicted 523
3 SASI_Hs01_00234402 predicted 528
4 SASI_Hs01_00234403 predicted 385
5 SASI_Hs02_00366993 predicted 532
6 SASI_Hs01_00234404 predicted 541
7 SASI_Hs01_00234405 predicted 541
8 SASI_Hs01_00234406 predicted 1200
9 SASI_Hs02_00366994 predicted 1201
10 SASI_Hs01_00234407 predicted 1099
11 SASI_Hs01_00234399 predicted 1084
12 SASI_Hs01_00234401 predicted 463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153038
CCDC140 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 140
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-533s1c1
Sequence:CCGGCACAGCCAACTAAACGGAGTACTCGAGTACTCCGTTTAGTTGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-542s1c1
Sequence:CCGGCTAAACGGAGTAAACGCAACACTCGAGTGTTGCGTTTACTCCGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-844s1c1
Sequence:CCGGGAGAGAAAGAAGGAAAGAAATCTCGAGATTTCTTTCCTTCTTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-822s1c1
Sequence:CCGGGAAAGAGAGAAAGAGAAGAAACTCGAGTTTCTTCTCTTTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-819s1c1
Sequence:CCGGGAAGAAAGAGAGAAAGAGAAGCTCGAGCTTCTCTTTCTCTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161622    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153038.1-962s1c1
Sequence:CCGGGCTTCCTGAATTTCTACACATCTCGAGATGTGTAGAAATTCAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-539s1c1
Sequence:CCGGCAACTAAACGGAGTAAACGCACTCGAGTGCGTTTACTCCGTTTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164482    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153038.1-1470s1c1
Sequence:CCGGCCTGTTCTTCTTCGTCTTCTTCTCGAGAAGAAGACGAAGAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166190    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153038.1-1204s1c1
Sequence:CCGGCGACACAGAAACCCATCGAAACTCGAGTTTCGATGGGTTTCTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153038.1-1114s1c1
Sequence:CCGGGCGAGGGACAGGAGAATAATTCTCGAGAATTATTCTCCTGTCCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-537s1c1
Sequence:CCGGGCCAACTAAACGGAGTAAACGCTCGAGCGTTTACTCCGTTTAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-535s1c1
Sequence:CCGGCAGCCAACTAAACGGAGTAAACTCGAGTTTACTCCGTTTAGTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-526s1c1
Sequence:CCGGGAGACTGCACAGCCAACTAAACTCGAGTTTAGTTGGCTGTGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153038
CCDC140 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 140
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-533s1c1
Sequence:CCGGCACAGCCAACTAAACGGAGTACTCGAGTACTCCGTTTAGTTGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-542s1c1
Sequence:CCGGCTAAACGGAGTAAACGCAACACTCGAGTGTTGCGTTTACTCCGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-844s1c1
Sequence:CCGGGAGAGAAAGAAGGAAAGAAATCTCGAGATTTCTTTCCTTCTTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-822s1c1
Sequence:CCGGGAAAGAGAGAAAGAGAAGAAACTCGAGTTTCTTCTCTTTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-819s1c1
Sequence:CCGGGAAGAAAGAGAGAAAGAGAAGCTCGAGCTTCTCTTTCTCTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161622    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153038.1-962s1c1
Sequence:CCGGGCTTCCTGAATTTCTACACATCTCGAGATGTGTAGAAATTCAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-539s1c1
Sequence:CCGGCAACTAAACGGAGTAAACGCACTCGAGTGCGTTTACTCCGTTTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164482    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153038.1-1470s1c1
Sequence:CCGGCCTGTTCTTCTTCGTCTTCTTCTCGAGAAGAAGACGAAGAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166190    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153038.1-1204s1c1
Sequence:CCGGCGACACAGAAACCCATCGAAACTCGAGTTTCGATGGGTTTCTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153038.1-1114s1c1
Sequence:CCGGGCGAGGGACAGGAGAATAATTCTCGAGAATTATTCTCCTGTCCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-537s1c1
Sequence:CCGGGCCAACTAAACGGAGTAAACGCTCGAGCGTTTACTCCGTTTAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-535s1c1
Sequence:CCGGCAGCCAACTAAACGGAGTAAACTCGAGTTTACTCCGTTTAGTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-526s1c1
Sequence:CCGGGAGACTGCACAGCCAACTAAACTCGAGTTTAGTTGGCTGTGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153038
CCDC140 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 140
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-533s1c1
Sequence:CCGGCACAGCCAACTAAACGGAGTACTCGAGTACTCCGTTTAGTTGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-542s1c1
Sequence:CCGGCTAAACGGAGTAAACGCAACACTCGAGTGTTGCGTTTACTCCGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-844s1c1
Sequence:CCGGGAGAGAAAGAAGGAAAGAAATCTCGAGATTTCTTTCCTTCTTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-822s1c1
Sequence:CCGGGAAAGAGAGAAAGAGAAGAAACTCGAGTTTCTTCTCTTTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-819s1c1
Sequence:CCGGGAAGAAAGAGAGAAAGAGAAGCTCGAGCTTCTCTTTCTCTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161622    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153038.1-962s1c1
Sequence:CCGGGCTTCCTGAATTTCTACACATCTCGAGATGTGTAGAAATTCAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-539s1c1
Sequence:CCGGCAACTAAACGGAGTAAACGCACTCGAGTGCGTTTACTCCGTTTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164482    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153038.1-1470s1c1
Sequence:CCGGCCTGTTCTTCTTCGTCTTCTTCTCGAGAAGAAGACGAAGAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166190    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153038.1-1204s1c1
Sequence:CCGGCGACACAGAAACCCATCGAAACTCGAGTTTCGATGGGTTTCTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153038.1-1114s1c1
Sequence:CCGGGCGAGGGACAGGAGAATAATTCTCGAGAATTATTCTCCTGTCCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-537s1c1
Sequence:CCGGGCCAACTAAACGGAGTAAACGCTCGAGCGTTTACTCCGTTTAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-535s1c1
Sequence:CCGGCAGCCAACTAAACGGAGTAAACTCGAGTTTACTCCGTTTAGTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153038.1-526s1c1
Sequence:CCGGGAGACTGCACAGCCAACTAAACTCGAGTTTAGTTGGCTGTGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks