EMAIL THIS PAGE TO A FRIEND

CCDC141

coiled-coil domain containing 141

130 Gene Product Result for
Synonyms: CAMDI
UniProtKB ID: Q6ZP82, Q8N8H3
Gene ID:
Mouse(545428) coiled-coil domain containing 141
Rat(311134) coiled-coil domain containing 141
chicken(770766) coiled-coil domain containing 141
domestic cat(101080563) coiled-coil domain containing 141
dog(478822) coiled-coil domain containing 141
sheep(101122576) coiled-coil domain containing 141
domestic guinea pig(100720013) coiled-coil domain containing 141
naked mole-rat(101704800) coiled-coil domain containing 141
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173648 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173648 Rosetta Predictions human pricing
XM_001066067 Rosetta Predictions rat pricing
XR_005532 Rosetta Predictions rat pricing
NM_001025576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167972 predicted 290
2 SASI_Hs01_00167973 predicted 1745
3 SASI_Hs01_00167974 predicted 509
4 SASI_Hs01_00167975 predicted 558
5 SASI_Hs01_00167977 predicted 519
6 SASI_Hs01_00167978 predicted 2377
7 SASI_Hs02_00368551 predicted 1052
8 SASI_Hs01_00167979 predicted 959
9 SASI_Hs02_00368552 predicted 2779
10 SASI_Hs01_00167980 predicted 2409
11 SASI_Hs01_00167976 predicted 2479
12 SASI_Hs01_00167981 predicted 2550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316209 predicted 4165
2 SASI_Rn02_00316210 predicted 2931
3 SASI_Rn02_00316211 predicted 3427
4 SASI_Rn02_00316212 predicted 1800
5 SASI_Rn02_00316213 predicted 693
6 SASI_Rn02_00316214 predicted 3223
7 SASI_Rn02_00316215 predicted 1241
8 SASI_Rn02_00316216 predicted 3028
9 SASI_Rn02_00316217 predicted 2295
10 SASI_Rn02_00316218 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168544 predicted 4166
2 SASI_Rn01_00168545 predicted 1796
3 SASI_Rn01_00168546 predicted 689
4 SASI_Rn01_00168547 predicted 5030
5 SASI_Rn02_00409602 predicted 1242
6 SASI_Rn01_00168548 predicted 4374
7 SASI_Rn01_00168549 predicted 2295
8 SASI_Rn01_00168551 predicted 200
9 SASI_Rn01_00168552 predicted 2070
10 SASI_Rn02_00409603 predicted 656
11 SASI_Rn01_00168550 predicted 4121
12 SASI_Rn01_00168553 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031387 predicted 712
2 SASI_Mm01_00031388 predicted 680
3 SASI_Mm01_00031389 predicted 753
4 SASI_Mm01_00031390 predicted 600
5 SASI_Mm01_00031391 predicted 422
6 SASI_Mm01_00031392 predicted 746
7 SASI_Mm02_00287928 predicted 558
8 SASI_Mm01_00031393 predicted 634
9 SASI_Mm01_00031394 predicted 237
10 SASI_Mm01_00031395 predicted 1185
11 SASI_Mm01_00031396 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173648
CCDC141 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 141
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173648.2-2822s1c1
Sequence:CCGGGCAGCATAGTTAATACCTTTACTCGAGTAAAGGTATTAACTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173648.2-1135s1c1
Sequence:CCGGCGGAATCTGAAGGCGCTTAAACTCGAGTTTAAGCGCCTTCAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173648.2-1032s1c1
Sequence:CCGGCGCCATGAGAGACGAGATAAACTCGAGTTTATCTCGTCTCTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173648.2-2574s1c1
Sequence:CCGGCCTGTCTAATGTAACTGTCATCTCGAGATGACAGTTACATTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173648.2-385s1c1
Sequence:CCGGGCGGCATTCAAAGAGCAACTTCTCGAGAAGTTGCTCTTTGAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173648.2-2651s21c1
Sequence:CCGGTGACATGGTGGGTAGCCTATACTCGAGTATAGGCTACCCACCATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173648.2-2740s21c1
Sequence:CCGGGTTTAGGGCTAGCTGATTAATCTCGAGATTAATCAGCTAGCCCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173648.2-2148s21c1
Sequence:CCGGTGCGGATGCATGCAATGATAACTCGAGTTATCATTGCATGCATCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173648
CCDC141 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 141
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173648.2-2822s1c1
Sequence:CCGGGCAGCATAGTTAATACCTTTACTCGAGTAAAGGTATTAACTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173648.2-1135s1c1
Sequence:CCGGCGGAATCTGAAGGCGCTTAAACTCGAGTTTAAGCGCCTTCAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173648.2-1032s1c1
Sequence:CCGGCGCCATGAGAGACGAGATAAACTCGAGTTTATCTCGTCTCTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173648.2-2574s1c1
Sequence:CCGGCCTGTCTAATGTAACTGTCATCTCGAGATGACAGTTACATTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173648.2-385s1c1
Sequence:CCGGGCGGCATTCAAAGAGCAACTTCTCGAGAAGTTGCTCTTTGAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173648.2-2651s21c1
Sequence:CCGGTGACATGGTGGGTAGCCTATACTCGAGTATAGGCTACCCACCATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173648.2-2740s21c1
Sequence:CCGGGTTTAGGGCTAGCTGATTAATCTCGAGATTAATCAGCTAGCCCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173648.2-2148s21c1
Sequence:CCGGTGCGGATGCATGCAATGATAACTCGAGTTATCATTGCATGCATCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173648
CCDC141 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 141
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173648.2-2822s1c1
Sequence:CCGGGCAGCATAGTTAATACCTTTACTCGAGTAAAGGTATTAACTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173648.2-1135s1c1
Sequence:CCGGCGGAATCTGAAGGCGCTTAAACTCGAGTTTAAGCGCCTTCAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173648.2-1032s1c1
Sequence:CCGGCGCCATGAGAGACGAGATAAACTCGAGTTTATCTCGTCTCTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173648.2-2574s1c1
Sequence:CCGGCCTGTCTAATGTAACTGTCATCTCGAGATGACAGTTACATTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173648.2-385s1c1
Sequence:CCGGGCGGCATTCAAAGAGCAACTTCTCGAGAAGTTGCTCTTTGAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173648.2-2651s21c1
Sequence:CCGGTGACATGGTGGGTAGCCTATACTCGAGTATAGGCTACCCACCATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173648.2-2740s21c1
Sequence:CCGGGTTTAGGGCTAGCTGATTAATCTCGAGATTAATCAGCTAGCCCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173648.2-2148s21c1
Sequence:CCGGTGCGGATGCATGCAATGATAACTCGAGTTATCATTGCATGCATCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025576
CCDC141 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 141
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025576.2-1241s21c1
Sequence:CCGGACGAGATGATGGGATACATTCCTCGAGGAATGTATCCCATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025576.2-290s21c1
Sequence:CCGGAGCCCAATCTCCTCGAAATTGCTCGAGCAATTTCGAGGAGATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025576.2-1390s21c1
Sequence:CCGGCCCATTCTTGCTACCACATTGCTCGAGCAATGTGGTAGCAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025576.2-1829s21c1
Sequence:CCGGTCGAGTTTCTGAACTTAATAACTCGAGTTATTAAGTTCAGAAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025576.2-2382s21c1
Sequence:CCGGTGGGTGGTGGTGACTTAATTGCTCGAGCAATTAAGTCACCACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025576
CCDC141 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 141
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025576.2-1241s21c1
Sequence:CCGGACGAGATGATGGGATACATTCCTCGAGGAATGTATCCCATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025576.2-290s21c1
Sequence:CCGGAGCCCAATCTCCTCGAAATTGCTCGAGCAATTTCGAGGAGATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025576.2-1390s21c1
Sequence:CCGGCCCATTCTTGCTACCACATTGCTCGAGCAATGTGGTAGCAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025576.2-1829s21c1
Sequence:CCGGTCGAGTTTCTGAACTTAATAACTCGAGTTATTAAGTTCAGAAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025576.2-2382s21c1
Sequence:CCGGTGGGTGGTGGTGACTTAATTGCTCGAGCAATTAAGTCACCACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025576
CCDC141 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 141
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025576.2-1241s21c1
Sequence:CCGGACGAGATGATGGGATACATTCCTCGAGGAATGTATCCCATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025576.2-290s21c1
Sequence:CCGGAGCCCAATCTCCTCGAAATTGCTCGAGCAATTTCGAGGAGATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025576.2-1390s21c1
Sequence:CCGGCCCATTCTTGCTACCACATTGCTCGAGCAATGTGGTAGCAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025576.2-1829s21c1
Sequence:CCGGTCGAGTTTCTGAACTTAATAACTCGAGTTATTAAGTTCAGAAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025576.2-2382s21c1
Sequence:CCGGTGGGTGGTGGTGACTTAATTGCTCGAGCAATTAAGTCACCACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks