EMAIL THIS PAGE TO A FRIEND

CCDC142

coiled-coil domain containing 142

105 Gene Product Result for
UniProtKB ID: Q17RM4, B7ZKV5, Q8NBJ3, Q8NBV2, Q96KA7
Gene ID:
Mouse(243510) coiled-coil domain containing 142
Rat(297380) coiled-coil domain containing 142
naked mole-rat(101698719) coiled-coil domain containing 142
domestic guinea pig(100712736) coiled-coil domain containing 142
sheep(101106927) coiled-coil domain containing 142
Domestic Rabbit(100348632) coiled-coil domain containing 142
domestic cat(101100882) coiled-coil domain containing 142
cow(538907) coiled-coil domain containing 142
Horse(100069070) coiled-coil domain containing 142
dog(612253) coiled-coil domain containing 142
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032779 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032779 Rosetta Predictions human pricing
XM_001072498 Rosetta Predictions rat pricing
XM_232111 Rosetta Predictions rat pricing
NM_001081266 Rosetta Predictions mouse pricing
XM_620337 Rosetta Predictions mouse pricing
XM_897533 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109085 predicted 264
2 SASI_Hs02_00360331 predicted 1203
3 SASI_Hs01_00109086 predicted 2262
4 SASI_Hs01_00109088 predicted 498
5 SASI_Hs01_00109090 predicted 337
6 SASI_Hs01_00109091 predicted 916
7 SASI_Hs01_00109092 predicted 2278
8 SASI_Hs01_00109093 predicted 1768
9 SASI_Hs01_00109094 predicted 1881
10 SASI_Hs02_00360332 predicted 2305
11 SASI_Hs01_00109087 predicted 1572
12 SASI_Hs01_00109089 predicted 2029
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339423 predicted 1029
2 SASI_Rn02_00339424 predicted 1796
3 SASI_Rn02_00339425 predicted 1473
4 SASI_Rn02_00339426 predicted 872
5 SASI_Rn02_00339427 predicted 1185
6 SASI_Rn02_00339428 predicted 712
7 SASI_Rn02_00339429 predicted 1514
8 SASI_Rn02_00339430 predicted 1339
9 SASI_Rn02_00339431 predicted 1262
10 SASI_Rn02_00339432 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386981 predicted 1029
2 SASI_Rn02_00386982 predicted 1798
3 SASI_Rn02_00386983 predicted 1475
4 SASI_Rn02_00386984 predicted 1459
5 SASI_Rn02_00386985 predicted 1181
6 SASI_Rn02_00386986 predicted 1520
7 SASI_Rn02_00386987 predicted 1704
8 SASI_Rn02_00386988 predicted 1265
9 SASI_Rn02_00386989 predicted 1396
10 SASI_Rn02_00386990 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296787 predicted 828
2 SASI_Mm02_00296788 predicted 2566
3 SASI_Mm02_00296789 predicted 522
4 SASI_Mm02_00296790 predicted 1571
5 SASI_Mm02_00296791 predicted 2678
6 SASI_Mm02_00296792 predicted 750
7 SASI_Mm02_00296793 predicted 1409
8 SASI_Mm02_00296794 predicted 1744
9 SASI_Mm02_00296795 predicted 2835
10 SASI_Mm02_00296796 predicted 1636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222515 predicted 834
2 SASI_Mm01_00222516 predicted 2571
3 SASI_Mm01_00222517 predicted 534
4 SASI_Mm01_00222518 predicted 1569
5 SASI_Mm01_00222519 predicted 2693
6 SASI_Mm01_00222520 predicted 748
7 SASI_Mm01_00222521 predicted 1409
8 SASI_Mm01_00222522 predicted 1755
9 SASI_Mm01_00222523 predicted 2843
10 SASI_Mm01_00222524 predicted 1650
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240011 predicted 1287
2 SASI_Mm01_00240012 predicted 514
3 SASI_Mm01_00240013 predicted 1012
4 SASI_Mm01_00240014 predicted 1496
5 SASI_Mm01_00240015 predicted 1215
6 SASI_Mm01_00240016 predicted 1236
7 SASI_Mm01_00240017 predicted 714
8 SASI_Mm01_00240018 predicted 747
9 SASI_Mm01_00240019 predicted 1391
10 SASI_Mm01_00240020 predicted 1621
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081266
VALIDATED
CCDC142 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 142
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081266.1-515s21c1
Sequence:CCGGAGCAGTTGCACGGCGATTTACCTCGAGGTAAATCGCCGTGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081266.1-1570s21c1
Sequence:CCGGGGCCTAGAGATCCACAATTTGCTCGAGCAAATTGTGGATCTCTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081266.1-831s21c1
Sequence:CCGGGGGTTGTCAGGTGGCAGATAACTCGAGTTATCTGCCACCTGACAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081266.1-1634s21c1
Sequence:CCGGTTGTCCAAGAATGCCATAAACCTCGAGGTTTATGGCATTCTTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081266.1-2766s21c1
Sequence:CCGGCTGTAGGGCCTGGACATTTAACTCGAGTTAAATGTCCAGGCCCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081266
VALIDATED
CCDC142 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 142
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081266.1-515s21c1
Sequence:CCGGAGCAGTTGCACGGCGATTTACCTCGAGGTAAATCGCCGTGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081266.1-1570s21c1
Sequence:CCGGGGCCTAGAGATCCACAATTTGCTCGAGCAAATTGTGGATCTCTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081266.1-831s21c1
Sequence:CCGGGGGTTGTCAGGTGGCAGATAACTCGAGTTATCTGCCACCTGACAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081266.1-1634s21c1
Sequence:CCGGTTGTCCAAGAATGCCATAAACCTCGAGGTTTATGGCATTCTTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081266.1-2766s21c1
Sequence:CCGGCTGTAGGGCCTGGACATTTAACTCGAGTTAAATGTCCAGGCCCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081266
VALIDATED
CCDC142 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 142
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081266.1-515s21c1
Sequence:CCGGAGCAGTTGCACGGCGATTTACCTCGAGGTAAATCGCCGTGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081266.1-1570s21c1
Sequence:CCGGGGCCTAGAGATCCACAATTTGCTCGAGCAAATTGTGGATCTCTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081266.1-831s21c1
Sequence:CCGGGGGTTGTCAGGTGGCAGATAACTCGAGTTATCTGCCACCTGACAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081266.1-1634s21c1
Sequence:CCGGTTGTCCAAGAATGCCATAAACCTCGAGGTTTATGGCATTCTTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081266.1-2766s21c1
Sequence:CCGGCTGTAGGGCCTGGACATTTAACTCGAGTTAAATGTCCAGGCCCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032779
CCDC142 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 142
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032779.3-2379s21c1
Sequence:CCGGGGAGGTCCAGACCACGAAATTCTCGAGAATTTCGTGGTCTGGACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032779.3-1333s21c1
Sequence:CCGGGCTCAGAGTCTGGACCTAAATCTCGAGATTTAGGTCCAGACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032779.3-1616s21c1
Sequence:CCGGAGCCCAGGTTACGACGGATTTCTCGAGAAATCCGTCGTAACCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032779.3-4007s21c1
Sequence:CCGGTGTAGTACTTTCACGTTTAAGCTCGAGCTTAAACGTGAAAGTACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032779.3-1464s21c1
Sequence:CCGGACTACTTCATCAGTCGCTTATCTCGAGATAAGCGACTGATGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032779.2-1651s1c1
Sequence:CCGGGAAGAGTCACTAAGTGTCTTTCTCGAGAAAGACACTTAGTGACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032779.2-2449s1c1
Sequence:CCGGCAGACATTTGGAATTGCATATCTCGAGATATGCAATTCCAAATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032779
CCDC142 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 142
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032779.3-2379s21c1
Sequence:CCGGGGAGGTCCAGACCACGAAATTCTCGAGAATTTCGTGGTCTGGACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032779.3-1333s21c1
Sequence:CCGGGCTCAGAGTCTGGACCTAAATCTCGAGATTTAGGTCCAGACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032779.3-1616s21c1
Sequence:CCGGAGCCCAGGTTACGACGGATTTCTCGAGAAATCCGTCGTAACCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032779.3-4007s21c1
Sequence:CCGGTGTAGTACTTTCACGTTTAAGCTCGAGCTTAAACGTGAAAGTACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032779.3-1464s21c1
Sequence:CCGGACTACTTCATCAGTCGCTTATCTCGAGATAAGCGACTGATGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032779.2-1651s1c1
Sequence:CCGGGAAGAGTCACTAAGTGTCTTTCTCGAGAAAGACACTTAGTGACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032779.2-2449s1c1
Sequence:CCGGCAGACATTTGGAATTGCATATCTCGAGATATGCAATTCCAAATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032779
CCDC142 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 142
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032779.3-2379s21c1
Sequence:CCGGGGAGGTCCAGACCACGAAATTCTCGAGAATTTCGTGGTCTGGACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032779.3-1333s21c1
Sequence:CCGGGCTCAGAGTCTGGACCTAAATCTCGAGATTTAGGTCCAGACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032779.3-1616s21c1
Sequence:CCGGAGCCCAGGTTACGACGGATTTCTCGAGAAATCCGTCGTAACCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032779.3-4007s21c1
Sequence:CCGGTGTAGTACTTTCACGTTTAAGCTCGAGCTTAAACGTGAAAGTACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032779.3-1464s21c1
Sequence:CCGGACTACTTCATCAGTCGCTTATCTCGAGATAAGCGACTGATGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032779.2-1651s1c1
Sequence:CCGGGAAGAGTCACTAAGTGTCTTTCTCGAGAAAGACACTTAGTGACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032779.2-2449s1c1
Sequence:CCGGCAGACATTTGGAATTGCATATCTCGAGATATGCAATTCCAAATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks