EMAIL THIS PAGE TO A FRIEND

CCDC144A

coiled-coil domain containing 144A

70 Gene Product Result for
Species: Human CCDC144A(9720)
UniProtKB ID: A2RUR9, O60311, Q6ZU57
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014695 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014695 Rosetta Predictions human pricing
XM_930399 Rosetta Predictions human pricing
XM_934726 Rosetta Predictions human pricing
XM_934727 Rosetta Predictions human pricing
XM_934728 Rosetta Predictions human pricing
XM_934729 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346082 predicted 2014
2 SASI_Hs02_00346083 predicted 3736
3 SASI_Hs02_00346084 predicted 3634
4 SASI_Hs02_00346085 predicted 3013
5 SASI_Hs02_00346086 predicted 488
6 SASI_Hs02_00346087 predicted 1945
7 SASI_Hs02_00346088 predicted 3933
8 SASI_Hs02_00346089 predicted 1700
9 SASI_Hs02_00346090 predicted 1709
10 SASI_Hs02_00346091 predicted 1860
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271547 predicted 569
2 SASI_Hs01_00271548 predicted 570
3 SASI_Hs01_00271549 predicted 571
4 SASI_Hs01_00271550 predicted 589
5 SASI_Hs01_00271551 predicted 578
6 SASI_Hs01_00271552 predicted 592
7 SASI_Hs01_00271553 predicted 1401
8 SASI_Hs01_00271554 predicted 3814
9 SASI_Hs01_00271555 predicted 3105
10 SASI_Hs01_00271556 predicted 2026
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278749 predicted 575
2 SASI_Hs01_00278750 predicted 581
3 SASI_Hs01_00278751 predicted 581
4 SASI_Hs01_00278752 predicted 603
5 SASI_Hs01_00278753 predicted 590
6 SASI_Hs01_00278754 predicted 605
7 SASI_Hs01_00278755 predicted 1412
8 SASI_Hs01_00278756 predicted 1318
9 SASI_Hs01_00278757 predicted 1777
10 SASI_Hs01_00278758 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271133 predicted 2188
2 SASI_Hs01_00271134 predicted 2119
3 SASI_Hs01_00271135 predicted 1969
4 SASI_Hs01_00271136 predicted 1407
5 SASI_Hs01_00271137 predicted 1234
6 SASI_Hs01_00271138 predicted 2348
7 SASI_Hs01_00271139 predicted 2640
8 SASI_Hs01_00271140 predicted 1015
9 SASI_Hs01_00271141 predicted 2349
10 SASI_Hs01_00271142 predicted 2476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278908 predicted 643
2 SASI_Hs01_00278909 predicted 561
3 SASI_Hs01_00278910 predicted 618
4 SASI_Hs01_00278911 predicted 604
5 SASI_Hs01_00278912 predicted 629
6 SASI_Hs01_00278913 predicted 558
7 SASI_Hs01_00278914 predicted 563
8 SASI_Hs01_00278915 predicted 608
9 SASI_Hs01_00278916 predicted 588
10 SASI_Hs01_00278917 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250873 predicted 553
2 SASI_Hs01_00250874 predicted 555
3 SASI_Hs01_00250875 predicted 554
4 SASI_Hs01_00250876 predicted 576
5 SASI_Hs01_00250877 predicted 561
6 SASI_Hs01_00250878 predicted 579
7 SASI_Hs01_00250879 predicted 3100
8 SASI_Hs01_00250880 predicted 2250
9 SASI_Hs01_00250881 predicted 1085
10 SASI_Hs01_00250882 predicted 1167
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014695
CCDC144A MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 144A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014695.1-3863s21c1
Sequence:CCGGACTTCGCAAGCCGACTTTAATCTCGAGATTAAAGTCGGCTTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014695.1-3982s21c1
Sequence:CCGGAGAGGTCAGTACGCAACTTACCTCGAGGTAAGTTGCGTACTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014695.1-4339s21c1
Sequence:CCGGTATGAACCTGGATCCTATATACTCGAGTATATAGGATCCAGGTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014695.1-5492s21c1
Sequence:CCGGATCAGGTGACCTGCAATTATTCTCGAGAATAATTGCAGGTCACCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014695.1-3654s21c1
Sequence:CCGGGTAAAGCTGAATGGCATAAACCTCGAGGTTTATGCCATTCAGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014695
CCDC144A MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 144A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014695.1-3863s21c1
Sequence:CCGGACTTCGCAAGCCGACTTTAATCTCGAGATTAAAGTCGGCTTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014695.1-3982s21c1
Sequence:CCGGAGAGGTCAGTACGCAACTTACCTCGAGGTAAGTTGCGTACTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014695.1-4339s21c1
Sequence:CCGGTATGAACCTGGATCCTATATACTCGAGTATATAGGATCCAGGTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014695.1-5492s21c1
Sequence:CCGGATCAGGTGACCTGCAATTATTCTCGAGAATAATTGCAGGTCACCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014695.1-3654s21c1
Sequence:CCGGGTAAAGCTGAATGGCATAAACCTCGAGGTTTATGCCATTCAGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014695
CCDC144A MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 144A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014695.1-3863s21c1
Sequence:CCGGACTTCGCAAGCCGACTTTAATCTCGAGATTAAAGTCGGCTTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014695.1-3982s21c1
Sequence:CCGGAGAGGTCAGTACGCAACTTACCTCGAGGTAAGTTGCGTACTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014695.1-4339s21c1
Sequence:CCGGTATGAACCTGGATCCTATATACTCGAGTATATAGGATCCAGGTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014695.1-5492s21c1
Sequence:CCGGATCAGGTGACCTGCAATTATTCTCGAGAATAATTGCAGGTCACCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014695.1-3654s21c1
Sequence:CCGGGTAAAGCTGAATGGCATAAACCTCGAGGTTTATGCCATTCAGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks